Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10713  (registered. 2012)
Contig Information
Length 781 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_SHDr Shoot grown with dessication 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255678102|dbj|BAF22728.2|| Os08g0109900 [Oryza sativa Japonica Group]
Score 352
Evalue 3.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10713
TTTTTTTTTTGTGAAAACATGACTTCCACAAAATTGAGACTAAACATTGAGTAAGACAATGTTAATATCTATATGTGATTTCTAGCTTTCAACAAGTTCA
GCATACAAATTACGGAGTACAAGCTCTGACAGAGGCCCAGTCCGGCAATAAAGTGCCGGACATGGCAACTTTGTGAAACCAGATTTATTCCTCATAGTCC
ACTGCATCCCCAGAAGAACCATCCTTGAGATGAAGGTGCTTCTCCCTCCTCTGGAAGTCAGTCAGGCCTTTCCCGCTACCAGTGACCCCCACCTTACCTC
TGTGATCTTCCGGTGACTTGAAGATGCTCTCCTTCTTGCGACCCGAAAAGAATCCCACCTTCTTAGCCTTTCCTTTGGTAGTCTGGAACTGTTGCCATGC
ATTTTGCCGCTTATTCTGTGCGAAATCTAGTTGCTCAAAGCGGGCTTTTGACTTGAAAGCATGGATCTTCTTACGCTTTGCAGCTTTCACATCTTCTGGA
TCATTTGGATCGATCTTAAGTTTTGTGGGTAAGCTACGAATCTGATAGTCAGATGTTGCTGCTTGTTCAACTTTTCTCTTTAATGCCATTTTTGTCGCTT
CAGCTTCTTTTTCAGCTAGTCCTAAAGCATCAGCAGCTTCCACGTCAAGTGCCCTGACATTAGCAGGGTCCACCTCTTCCTTGTTTCCCCAGCCTTCATA
ACTTACAAAATAACCAATTGGTGTCAGACCTTCAATTGTCGCATTGTACCACTCCCCATCTTCACTATACACAGCTTGCAC
page-top