Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1071  (registered. 2012)
Contig Information
Length 1201 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_r Root 1
Wh_SH - 2
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 17
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238014838|gb|ACR38454.1|| unknown [Zea mays]
Score 210
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1071
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAATCCGTCGNNNACGGCACCGTCCGTC
GCTCGGCCAATGCCTCGACCACCTCCCCTCCTCGGAGCGGGTGGGGGCCCGGGGTAAAAGAACCCACGGCGCCGAAGGCGTCAAGGAACACTGTGCCTAA
CCCGGGGGCATGTCTAGCTTGCTAGCCGTCCCTCGTGTTGCAAAGCTATTTAATCCACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAA
GAACGTAGCGAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCAC
GCCTGCCTGGGCGTCACGCCAAAACACGCTCCCAACCACTCTCAACGGGAATCGGGATGCGGCATCTGGTCCCTCGTCTCTCAAGGGACGGTGGACCGAA
GATTGGGCTGCCGGCGTACCGCGCCGGACACAGCGCATGGTGGGCGTCCTCGCTTTATCAATGCAGTGCATCCGGCGCGCAGCTGGCATTATGGCCTTTG
AACGACCCAACAAACGAAGCGCACGTCGCTTCGACCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA
ACTTACAAGGATTCCCCTAGTAACGGCGAGCGAACCGGGAGCAGCCCAGCTTGAGAATCGGGCGGCTGTGCCGTCCGAATTGTAGTCTGGAGAGGCGTCC
TCAGCGACGGACCGGGCCCAAGTCCCCTGGAAAGGGGCGCCTGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACG
AGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGCGAGTGAAG
GAGGAGAAAATAGAAATTGGCAAACGTACATTTGTCTCTGCTGCCAAAAGTGTTGTTGAATATTGGATGGGCTATGTGTGAATGTTGTTCATTTAGAAAC
AAAAAAAGATGTTGTCAGTTGTCCGTTATTCGGTGCCCAGGTGCAGATCATGAACAGTAAATTCAAATAAAATAGCAAAAGAATTCAAAATAAAAAAAAA
A
page-top