Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11903  (registered. 2007)
Contig Information
Length 388 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0732000 [Oryza sativa (japonica cultivar-group)] >gi|57899150|dbj|BAD87012.1| unknown protein [Oryza sativa Japonica Group] >gi|57899708|dbj|BAD87428.1| unknown protein [Oryza sativa Japonica Group] >gi|113533683|dbj|BAF06066.1| Os01g0732000 [Oryza sativa (japonica cultivar-group)] >gi|218189006|gb|EEC71433.1| hypothetical protein OsI_03631 [Oryza sativa Indica Group]
Score 199
Evalue 2.50858e-14
Total Hit Count 33
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11903
TTTTTTTTTTGACCCCAAATCAGAGCAATCCAAAGAGTAATCGAAATTATTGGGGAGAAATACAAATGTTGATCAATTCAATACGCGCACAGCCGTGCGG
ATCGGGCCGCGGAAAATAGCTACACGGGGGAGAGGAGCTGCGCGAGGCTGGGCTTGGGCTCGGACCTCATGCCGACGAGGATGACGAGGGGGATGAAGCC
GTAGTGCGCGACCACCTTCGCGTTCTTCATCGCCCAAGTGCTCCACTCACGCGCCAGCCGCGCCGCACACGCCGCCGCCGACTCCGCTGCCTCCGCTGGG
GCCTTCCCCTTCTCCATGGCCGCCTCTGCCAATCGCGTCGCCGAGAGAAGAATGATTTGGAATTTTGGATATTGCAGCTTGTGAGTTG
page-top