Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11883  (registered. 2007)
Contig Information
Length 939 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31894 [Oryza sativa Indica Group]
Score 358
Evalue 4.03297e-32
Total Hit Count 48
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11883
TTTTTTTTTTGAATACCGCCCCAAGCTCCCACGTGATATCCATTCCATCTTTTAATCCCGTCTATGTACAAATATTTACAGCGACAAAATCAACTTGCAC
TTCTACAGCAAGTATCTTCATCACCTCTTCCACCAAATGGGCGGTCCTACCTTTTGTATTCCAAATGGCTGGTCAGGGGCAAATCTCCAAAAGACCTACC
TACGTCACAAGAACTTGTCTCACAAAATCAGTTGACATGTCAGCTTCAGTAACTAACAATTCAAGCACCGCTACGGGCCTTGCCTGCACATCAAGGCAGC
CACAGTATTCCGCGATCAGCGCATCATGTTAAAAGCTGCTAAGGATCATCCACTACCACCTTTGCTACATGGTCTCATTTTTGTTTCTTCTTAGGCTTCT
TTGACGATATAAGAGCTGAGGAAAGTAAAGACTCAACGTCCTCCCTTTGACGCTTCCTCGCTGCAATTTGGTCCTTTTGACTAGTTACAGTTTGCTTAGC
AGCTTGGCTTGTCGTGAGGTCCCGTATATGGCTGCTTGTTCCATCAAAATGTGATGAAACTGATGGATCCACCTGATTCGAGTTCCCAGATCTTGGTTGT
TCGGTAAACTTCCTTGCCCCCTTGACCTTATTTTTCTTCATATCAGGGATTGTTGGTGGACCAGTACCACTGTTCCTATTTGCTAATTCCGAAACTGCGT
CATCTTTAAGCAAGGAACCCTCTTTGTTTGAATTACTGAACCTTGGTGTTTCAGAAAACTTCCTTGCTCCTTTAGCCTTTTGTATCAAATTCTGCATTTC
ACAGTGTTGTGCTGATGAAGAACCATCATCCTGCTTGGCCACTGATTTTACAACAGAATCATGTTTTGACGAACCCTTGATGGTTCCCATATCATTGTTT
TGGTTGGCAGCCTTTTTGTCGNAATTATGTAATCTCACC
page-top