Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11831  (registered. 2007)
Contig Information
Length 1267 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein binding protein [Zea mays]
Score 269
Evalue 8.46629e-28
Total Hit Count 36
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11831
TTTGCTTCCGTTGCACTTAGCACGATTCTGGTCTTATTAATGTTGGGGGCGAGCACATGCTGCAGCGCACGGTGCTCCAGTTCTTTCATTCAGTCAAGTT
CTTTCATTCAGTCATGTTCTTTCATTCAGTCAAATTCAGTCAAATTTTCTGAAGCTAGCATCCTTTTTTACTACGTACATCCTTTTTTTGTTTTCAGCAA
CTATAGGTGCTACTACATCTCTCTTTTTTTTGCAGGGACCAGGGCCAGGAATTAAAAAACAAACAAAAGCAGGGGCCAGGAGTACATCTCAACTTTTACT
GTATTTCTTGCTGACAACTAGTGCAAGTACACATTCTGAATATTGAAATTATCTTCTGTTAGTTACTAGGATAGTGGTTCATCCTGCTTGTCTGATCTGT
GGAGGAGACCAAGGGCATCAACCTCCCCAACTTGAATTTGTGTTGTTGTTACTTGACATGTTTGTGTTCCTCATTTGGAGTCAGGTAAGACCTGTGATAC
TTTGGAGAGGGACTTGGTAGTATTATATGGGCAGTTTGGCCACATAGTTTGGCAACCTAGTTTGAGGAGAACAAGTTTGCATGCTGATAATCTTACCTAC
TTTGTGACAGATCAACATATAATTTCTTCTAGAATTTGAATGATGTGTGCTAAACTGCTAATAGTATACTAACCATACCTGGTTCAGCTATAGAGAACAA
GTTTTCATGCTGCTGATCTTACCTACTTCGTGACAGATCAACATATAATTTCTTCTGGACTTGGAATGATGTGTGCTAAACTGCTAATAGTATAATAATA
AAACATATAGTGCAGTCATTGATTTATCATTTATGTAACCTAATGTGTGATTCTTTTTGTCATTTTGTTAATCAGGCTGTGGCATGGGACACCTATCCTT
GTGGTCATCAGCATCCTGGCATACTTCTGCTTCTTGGAGCAATTGCTGGTTGCGCATAACGGCTTCGCCGCCCTGGCGATTTCGCTGCCCTTCTCATGCA
TCCTAGGCCTCTTCTCATCACTGACCACAACAAGCATGGGGGCGAGGATATGTGGATCTTCGCGGCGATCCAGTTCCTCTTCGTCGTGTTCTTCACAACT
CTGTTCTACAGATATCTGCATCTGCAGGCTGTGATTTCCATCATCCTGGCAACCTTACCATGACACTACTATTATTGGACCATTACACTCATCTCTACCT
GGAGAACAAATTCCTTAGTGCAAGTTACTGATTGAATTTACACTCATCTGCAGAGCGTGAGAAAAAT
page-top