Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11826  (registered. 2007)
Contig Information
Length 947 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloride channel [Oryza sativa Japonica Group]
Score 954
Evalue 3.14961e-101
Total Hit Count 358
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11826
GCTTTTTGAAACTTTAGCATGTATGTTTATCTTTTGAGTTCCAAGGTTTTGAATGTTTAGTCTACAGTTGGCACAACGATTCCTGTCATAGGCTCATAAT
AGAAAACTAGGGTTGCCGGCTTCCCTGTCATCAGTTCACCCACTTCCTTGACCTTCTGGCACTAGGCAGACGTCCAACCATGTTGCCACATTATTATTAC
AAAAGCGCAATCTGATTGATGTACACAAGACTCGTATGATTTTTGTGAATGGGAAGAAACATAAAAAAATTCACAATCAACCTCCCATTGAGGCTGAATG
AAAGTTGTGAGGATTGAGACTTGGGAACAGGTCGTGGATATGTTCCGCCACAAAATCATGCCTTGTGAGAATTCCAACAATGGGAGGCCTGTATGGGGTC
TTTGGAACAACCAAGAGATGCCTCAATCCTAGTTCTCGGAATAGGAGTGCAGCTTTTGCTAGTGACATTGTCTCAACCACCGTATATGGTGAGGTGTTTG
CAATTGCATGGAGATCCACATACATTTGCATCTCCTCATCAGTGAAATATAGATCCTCAATTTTCAAACCCTTCCCTGACCCTGCCTTAGCAAAATCAAA
GGCACCAAATCTTTCCATAACAAAGCTACCACTCATTTTCACTGGCTCCTTCATGAACATCTTGCCTTTCAGCAAAACCAATAGATGAGACCTGATCACA
AGCCCAACCAACTCAGGCACTTCTGTTAGAGGTGGCTCATCAACCACTGGAAACCCATTGTGGCCCGTGATCCTCAACGCAGTAACAATGTCCCCTACCT
TCTCAACACCTGAAAAGGTGATTAGTGGGCCAGACACGACATCACCAGCAACCAGATGTCTCATGTACGGTTCAGCATGAGCCTCCATGTACGGCAAACC
TTTCATTACCACTATTTGATCATAAACTCCTTTGGTAAAGTTATCCG
page-top