Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11737  (registered. 2007)
Contig Information
Length 1276 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0769200 [Oryza sativa (japonica cultivar-group)] >gi|14209565|dbj|BAB56061.1| putative meiotic serine proteinase [Oryza sativa Japonica Group] >gi|53793570|dbj|BAD53340.1| putative meiotic serine proteinase [Oryza sativa Japonica Group] >gi|113533902|dbj|BAF06285.1| Os01g0769200 [Oryza sativa (japonica cultivar-group)] >gi|125572163|gb|EAZ13678.1| hypothetical protein OsJ_003503 [Oryza sativa (japonica cultivar-group)]
Score 1518
Evalue 1.97268e-166
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11737
ACATTCTCTTTACAGTTATTGTTCACCTAGCCCACTCATCTACTTACATGGACGACATGCTTCAAAATGTACACCAAACAAAACAGCTACGAGTAAGTAA
ATCCTGGTCATTCTACCTCCAAAGCAGTCAGGTCACCGCTGCGTATACAACCTTGATGGCTTGATCAGTCAGGACACCGTTACAGCGTCAGCTTTTCAGT
TATCAGGAACTCTACACAGCCTTGGACATGACCGTGAACGGAATGACCACCCGGTGGCCCCTGTCCCCATAGAACTCGACGTCCCCGAAGCTCGCCGAAG
AGTTGGTCATGGTGGCGTTCACGACGAAGGTCACGAGCTGCTTCTGCCCGCTGGGGATGAAGAACTGTGCTGGTGCCGCGGACGCCGCCACCCCGTAGGG
GGCGTTGCAGCTGACCGTGTAGTTCTCGTCGCTCGCCACGTTGGTGATTGTTCGCGTTATTGTTCTTGACTGGTTGAGCACGGCTATAGTGATCGACGGC
AGGTTTAGGTCTGCTCCGGTCATGGTGGAGGCCCTGCAGCTGCTGCCGGTGTAGTTCGCCACTACTGGAGCAGAACCATTTATACCACACAGAAAGGAGA
GGTAGTCATCATAGCTGCAATCAAATATGAGCCCAGGGTCCAAAGCAGCAGTGGCATTGGCAAACCCATTCCCCATGTCAAAAGGTGTAGCTGGAGTTTG
AGTGGAGTCTGGGTTGCTGTATGTTCGCTGTGACATGATTGGATTCCCCTGCTTGTCACTGAGAGTTGTAGTGGTAGACAGCGCGGAACCTATAGCTGCT
GGGCTAAAAGAAGGAAACTTCTGCTTGATTAGCGCCGCAAGGCCAGCAATGTGTGGTGCAGCCATACTTGTACCAGAGAGCATCGCAAAACTTTCACCGG
TAAATTCAGCAGAATCCAATCCACGCGAACTCCAAGCACCCCAAATGGAACTGCCAGGTGCTACCACATTTGGTTTCAAGATATCGGCATTGGCCAATGT
ATTATCCTCAGGGTCAGGTCCCCTAGCAGAATAAAACATCACTTTTGGTGCCGAACTACCATAATTTGGCTTCAGACCTCCTAGTATTTTCGCAACTGCA
CCGAAGTTGACAACTTTGTCTGACGTCCCATCTCGTACAAGCGAATCGTTGTAATAACTTAGGAATATCTTAGAGTCATCAGATGATGGTATTATAAGTC
CAGGTATATCCATTGGAGTTGGGTTCAGCTGGAAACCAAGGACAAAAGGATCCAAGTAAAATATAATTCCTGCAGC
page-top