Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11717  (registered. 2007)
Contig Information
Length 661 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0550600 [Oryza sativa (japonica cultivar-group)] >gi|50725755|dbj|BAD33266.1| putative alkaline/neutral invertase [Oryza sativa Japonica Group] >gi|113536626|dbj|BAF09009.1| Os02g0550600 [Oryza sativa (japonica cultivar-group)] >gi|125582471|gb|EAZ23402.1| hypothetical protein OsJ_006885 [Oryza sativa (japonica cultivar-group)] >gi|215734976|dbj|BAG95698.1| unnamed protein product [Oryza sativa Japonica Group]
Score 570
Evalue 5.37001e-57
Total Hit Count 102
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11717
CCCCTCGCCTCGAGATTCGCGCGGCCGTGTCTGCCTCTGGGTCCGCGCTTCCGTTGTCTAGCGTCCTGAGCTGAGCTAGATCTCTCAGCTCGCTCTTTGC
CGGCGCTTTGGGCTTAGATCTGGCTGGGGCGAGTAGGCGGAGGCCGATCGCGGATTCGTGACGAGGGAGGGGAGCCATGGAGCTGGGGGCGGCCGGGATG
CGGCGGTCGGCGTCGCACAACTCGCTGTCCGGGTCCGATGACTTCGACCTCACACACCTGCTCAACAAGCCGCGGATCAACGTCGAGCGCCAGCGCTCCT
TCGATGACCGTTCGCTCAGCGACGTCTCCTACTCCGGTGGCCACGCCAGAGGAGGCGGAGGCTTCGACGGCATGTACTCCCCCGGCGGCGGTCTACGCTC
TCTGGTCGGCACGCCGGCCTCCTCGGCGCTCCACTCTTTCGAGCCCCACCCCATAGTGGGCGACGCCTGGGAGGCCCTCCGCCGCTCCCTCNTCTTTTTC
CGCGGCCANCCGCTTGGTACCATCNCCNCTTTCNACCATGCATCCNANGAANTCCTAAACTATGATCANGTCTTTGTGANANATTTCNTGCCCANCNCCA
TGGCNTTTCTNATNAATGNTGANCCNNANATTGTNAANAANTTCCTGCTCAANANCNTTTT
page-top