Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11657  (registered. 2007)
Contig Information
Length 1118 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18555 [Oryza sativa Indica Group]
Score 256
Evalue 3.56075e-20
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11657
TATCGCCGACAGGGCGAAATGACAATCATACGCTTTTTGTTCCCATACATCCAAAATTATTACAAAATTTTGGAACTTCCTGAGACAAGTGATAACAGAA
AAAGGAAAAATCATATGTGGATGGCCTTAGAATGGGTTTGCAAGCAAGCCTCCTTGAGGGCTTCACTCACAGTGGGATGTGCATGGCATATTCGGGCAAC
ATCCTCGCTGGATGCTCCATACTGTAGGGCAAGCACAGCTTCATGGATGATCTCTCCAGCATTCTGCGCCATTATCCTCGTGCCGAATTCGGCACGAGGC
TAATATCTGCACTTAATAAATCTGTACTAGACAAGAAGGTTCTCATTACAAACTTTGCCAATGTTGACTTCTAAAAGTAGTTTACATGTGAGAAAAATCT
CAAAATCTTTTCATCTTGTAGGCTCAAGCAACCATTTCAGATTACTTGCACCAACATGAAATAACAAAATCACTTGTGACTAAGGAGTTGGTTTGGTTCC
TGGCTTCTGCTTTGCTGGCTCTACCTGTGTTTATTATGTACAGGCTTCTAGTAGATACCTTCTGGTAGTTTGTTTTACTTTCGTTAGCCAATATAATTCT
AATTATCAACGCTGCGACCTTGCGTGAACTGATAGCATAATTGCCTTGAAACCTCTTGTTGACACAGCACGAAGAAGCAGAAGAGATCGCCTCTTAATGG
TAACGGAAACAATGGCAATAGGAGACACAAGCGCCGACATGCTGAGAAGTAAACTATCGTCGGCTGCCATGTAGGGTTGCAGAAATCAGAGCATGTCCTT
CCCTGATGAGGCTGCGCTCCTGTTCATGGTAGAAGGATGGAACGCTGTACACCACCAGATTTTTTCGTTTTCCTTTTGCCCCCTATTGTACGGACTCTAG
TTTCAGCAGCGGCCTTATGTATCTGCATCTTGCCGAGGTTTAATATGGGCTTAAACCTCGGCGTTTGTTAATTGTTTATTGTAACTTTGTTGATACGCTT
GAGTTTGTTTGCAGCGTGCTTTGCTAGTTTTTGTTCTCGCTCATCGGCATCCTAACTATACGAGATACGGTTGTTCTACAATTTATGTAATTAAAATCCG
TACGTGCTAAAAAAAAAA
page-top