Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11615  (registered. 2007)
Contig Information
Length 917 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_001447 [Oryza sativa (japonica cultivar-group)]
Score 87
Evalue 1.02907
Total Hit Count 4
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11615
TGTCGTCTTAGGCTCGGACGTTGTTGGTCGCCGGCTTGGCCTGCAAGAGGATGCCCCCCTGCTCTGACTTGCTCACATCTCAGTGTTTCACCAATGAAGA
TGTATTTTCAAGGTGAAGGCCTTGCGTTGGGACTCTGTGCCTCCTAAACTAAGAACAAATGAACTTGCCTTTAGGCTTTTCGCACTGCACTATGCATCCA
GGTCCAACCCAATGGTTAGGACGGCGGTTCTTGCATAGCATACATGGAGATGGTACATGTGGGGAAGAAATATAAGAAACTCATGCTCATCAGCGAGGGC
AGGGGTCATATAGTCTTCCACTCCATCACCTTCCGCTCGGCCACTTTCGGCAAAGCAGACTATGTACAACCTCTTCTTTTTGAAGCCCTCGGCCCCTCAC
CACCTGTTGAAGTTGAGGGCAGCAGCTCGCATGGATAGAGGTCATCCATGGCTTGAGTGAGTAGCCCCAAAAGCAGGTGGTATGGCAAGCCGCGGGAAGC
TCAGGGCAGGGTCAGCAGCTTCAACAGCTTCAACTGCACCAATGCAACTGTATGTCTCTTCAGAGATGTGTCGTTAGCTGATGAGGTTATCCCCACTAAA
GCCAAGAAGGTCAGGCGCAACTAAAACCAGGAAGGCCAATTGTTGTTAAGTGCTCGCCCTTTTGGACCTTATCATTTTGTTTGTGGATGCGCGAAAGAAT
GATGTCTGGATATGGGAGTGTCTCTTTAGATGTAGATATAGATGGTACCTGAAGCAACTAAACCGCGTATGGGGATTTAACATTGTCTTTGGTGGAAAAG
GCCCTCAATTCTCGGCCACTGTTCTATTTTTGATTTCTTGCTTGGTCGTGTAGATGTCGTGGGTATTGTAGTCAAGGTTTCTGATGTACTCCTGTTCCAG
CCGCAAACCATGGCAAA
page-top