Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10674  (registered. 2012)
Contig Information
Length 1246 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32401360|gb|AAP80852.1|| EREBP transcription factor [Triticum aestivum]
Score 616
Evalue 2.00E-174
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10674
TTTTTTTTTTATTTTTTTTTTAACAAACACTGGCTTCAAATTTAAAAGGTTTACAGCCTCTTGTAGCAATTACAATAAGGTAGAAACATGAATACAAAAT
AAGCAGTTCCCCATCACATACTGGTCTCATATATAGATATAATATAGTCTGGGGGCACAAGACAGAGGTCTATTGCAAAAGACCTCAGTCACCTGACCAT
TTAAGCTAGACATAACCATAGACTGACATCGCTACTGCTCAATTCTAGAGGCACCAGACACAAGCACTTGTTGATGTCCTGAATACTTATTCCTTTGTCT
ATATATACAGGCACCCAGCGACCTCGATTCCCTCAGTAGAAACCAGCAGACAAGGGCATGTCATCAAAGGTCCAAAGGCCCATGTTGCCGACCACATCCT
GGGGTACATCACAGCTTAGAATGCTGTCAATTGACTCATCTGAACCATCGTCCATCAGGAACTTCATGTATGGCTCCAAGTCGGCAAGATCAACATTAGC
ATCACCCATCACAGGAGGTACCGTTGAATTGATGCCATTGTTCTGGAGAAATGCAGATTCATTGACCTCTGTTGAGGTGGGAATGGATGCAAGCACAGAA
GTTATGTCAGGGGTCTTGATATCATTCTCCCAGCTGAAGTCTGAGCAACTAAAGGAGTTGCTACCCTGGTCAGAGGAAAAATTCATGAAAGGGGCCTCAA
CTGCATTCACTGTAGGCACAAACGACATGTTCTGAGGCTGCACAAATTGCTGATTTAAGGTGTAGTCAACAGCAGAGCAGGAATACACATCTGCGTTGCC
CATGGTGTTGAGTACCGGCTTCTGTTCGGTGTTGAACTCGGGCACCTTCACAGCAGTAGCGCAGCGTTGCTGAGGAGCCATAGGAGCTTCTTCTGGGAAA
TTGACCTTTGCCTTCTTGCCACGAATTCTGCGGGCTTCAACATCATAGGCTCTGGCAGCTTCCTCAGCGGAGTTGTAAGTACCAAGCCAGACACGGACAC
CCTTGCGAGGATCTCTTATTTCAGCAGCCCATTTACCCCAAGGGCGGCGGCGGATGCCCCTGAACTGGTTCTTTCTCTTCCTTTTAGCAGACCCTGAGGC
ACAGTCATCATCACCAGCAGCAGTTGCCTTCAATCCATCTCCGGAGAAGCCGCTCCTGCGGACGGGGAAGGGCTTGGCCTCGCCGTCGGACTCCTCCTCC
GCCTCCACGAACCCCTCGAAGTCGGCCTCGAACTCCGCGTCGCCCT
page-top