Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10672  (registered. 2012)
Contig Information
Length 1640 bp
Clones alternative view 38 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32401390|gb|AAP80864.1|| glucose-6-phosphate/phosphate translocator [Triticum aestivum]
Score 744
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10672
TTTTTTTTTTAAATATCAATAATTAACCGTTAAGCATAGGGCTATCGTTACTTTCCAGCAACGGAACTGTCAGACGAATTTCCATGCAGTTCTTATTTCA
GGATACAACGACAGTTCATGGCCACTGGAGTTCAGTTTGTGATTTAACAAATAACAAGGAAACAGCAACATGGTCCATTATTATTATCGCCTCTCGCATG
AAAACCTAAACCTGTATCAACAAGACACTTGCACAAGCAAAATTTGCCCCAGTGCTTGGTACTATTTCTGCAGACATTCTTCGTCCATGAACCTGACCTT
CAACAATAGTTCAAACCTCACTGCTTTGCCTGAGAGTACAGGAATGTGCCAAAGATGGCAATGGCAGCTCCTAGTGCATTTACAGGGCGGACAGGTGTAC
GGAAGATAATGATTGACGAAACAATAACTGATATGCGCTTCATTGTATTGCCAATGCTAAACGTCAATGGAGAAATCTGGTCCAAAGACATGTAGGACAC
CTGATTATACAGGTGGTAGAAAACGCTCTGTGCACCAATCCACCAGAGAACGTTGGGGCCAACATCTGCAAGAGCCTTTTGCCATCCAGCGGCCCACATT
TGGGGGCCTTCCATAGCAATAGCAAATGGTGTGAGTATGACCAGGGACATAATTGAAAGGCAAGCGTAGTAATTCATGCCACTGACAGACTTCCCTTTCA
TGCCCCGCTTCGAAAAGATGTTGCGGAAAACAAATGCAAGGTTCGATATCATGGCACCCATAAATCCAATCATATTAAAGTTCAGCTCTGTCGCAGCAGC
TAGACCACAACCACCAATGATCGGGAGAAGAGAAAGATATACAGGCATCGGAAATGACTCTCCGAGAATGAACCTTGACACCAAAACACTGAATGCAGGC
TCAGCACTCTTGATAATGTGTGTGAATGACACTGCCACCTTTGACATGCTCACTGTGGCAGCAACATGTCCAATTGTATGAGCCACAGCAACCGGGAAAA
GTGCTTTCCAGAAATCCAAGTCAGTCTTGGGGGCCTCAACTAGGCAGGTGACCCATGAGAAGAGCATCATCGCTGAGCCGCAGGCGAGGGATAGTGTGGA
GGTGAGCCAGGGATACGGGAAAGCATTGAGAACCTTCTTGTTATAGATGTTAAAGATTACATTAAGCGCCCACCAAGTCGCAAAATAGATTGAAATCTTC
AACTTTTGTGCTGCTTCTGAGCTGGCTGGCAACACCTCAGCCTTTGACTCCTTGTCATCAGCCGCTGAAGCTGCACACCGGAAGTCAAGCAGCTGCCTCC
GAGGCTTCAGCTCGGAAGTGTGTGGGTCATCTAGCCATGTGAGGTAGAGTGGTCTAAGGGAGCAGGACGCAAATTTTTTCATGTTGAGAATGGACACCGA
CGGAACAAAAGCTGATTTAGACCGTTGATTGGTGACAGAGAAGGCGGCCGGAGAGAGCTTCACAGCAGGTATCATGGCTCCTCTGCAAGATCTCACCTTT
CTTCCCGCCCAAGAAGACTTGCTCGGATCAATAAAGTCTTCTTCTCAAATCGCGGCAAGAAGAGGTAAAAGCGGCGCCTCTGCGACGAAGGATTCGAGGA
CGGCAGAGGCAGGTGGGGATAGCTGGGGATCAAGATCGAA
page-top