Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11482  (registered. 2007)
Contig Information
Length 298 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GI14297 [Drosophila mojavensis] >gi|193909190|gb|EDW08057.1| GI14297 [Drosophila mojavensis]
Score 74
Evalue 7.91384
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11482
TTTTTTTTTTGGCTTCAGAAATATAATGTATAACGAGGTATATGCTCATACAGAACTGATATTAAGTTTTCAGAATCTAATCCTCATAGGTCCATGTGTC
ATGATTCATACTCCTAACTGTACAAAGAAATATTGCTGACTTATTATTGTACTGCTAATACATGCTAAAATGTGAGGATTGATCTTACGGCATACCAATA
CATGATCGATGTAGTAGGATCCTCCTATCTCATCAAAAACAAGGCAGTGACAGCAGACAGCAACAGAGCCCCCATTTTCATGCCCATTCCCAGTGCTG
page-top