Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10663  (registered. 2012)
Contig Information
Length 868 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435602|ref|NP_001042559.1|| Os01g0242900 [Oryza sativa (japonica cultivar-group)]
Score 249
Evalue 2.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10663
TTTTTTTTTTAGTCTCAATCTGATTTATTTGTGACCATAACAAGGACTTAGTTCTCCTTGTCATACATTGAATATTCAAAGTTAATAATCAAATACAGTG
CAGAAGACGCGACATGACATCTTTCTTCATCCATGAAATGTACAATATGTACAGTGACACAATGTAGACTGACATCAATAAACGTGAGCTCCAGCAGTTG
CCCCGATGATGACGGCAATTGTAGCAAGGACAGCCGCTATTGTGCATGCCACATATCCTGGTTTCTCCCTGTAATCCACTCTGGAACACCACAACAGAAA
TGCTCCGACATACCAGGGGATGGCACCAAGAAAGAAACCGAGTACGAATAGAAACCATCCCATGCCAATACCAAAGCATGGAAGGCGGTCATGTTTATGT
CCACGGGCACCTGCTTCGTAATCTTGAGCGTTCCCGGCCTGGTACCCGCCGCGGTGGCGCGAGTTGGGCTCGCGCTGGCCGTGGAGGCCGGGCGGCGGGG
CGGGCTGCGGGTGCCCGACGGGCGGGCGCGGGGGCGGGTAGCTGGGCGGACCATGGAACGTCCCGTACTCCCCTACGCCGCCGACGCCGGCGGCGGCAGC
CTTGGCCTTCGCAACCTCGTCCCCGCTCATCTCTCCTCCTGCCTCGCCTCACTCCGCTCCGCAGCACCGGCCTGCATGACTTTCGCTGGTAAAGGGTTTT
CTGTATGGACGGTAAGCATGATGATTTTGACATCAGCTGTGGAACGCGCGATTTTACGCGTCGCCTCAAGACCGCCAATGCCCGGCATACTCATGTCCAT
TAGNACCACGTCAACGGCATTTGTCCGGCACCACTTAACGGCGTCTTCACCGCACGATGCCTCACCGA
page-top