Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10662  (registered. 2012)
Contig Information
Length 1137 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_SH - 1
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_VHS Shoot with heat shock treatment 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224589278|gb|ACN59489.1|| BAXI.2 [Triticum aestivum]
Score 486
Evalue 2.00E-135
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10662
TTTTTTTTTTCGTAAACCAAACCAAATCGTCTCAGGTTTCTATTATCGTGACGGTAACAGGAACACAAGAGATCCGGAACGCAGACAGCATCTGCAAATG
CTTCATCAGCAGCATCAAACTCACACAAGGTTCACACGAGCGCGGATTAACAAGGGTGGCACGGCGCCAAGTTACTGCGCCAGCTTAATTCCTACAAGTA
CTTAGCAGTGGTGGTGGTACCAGTAGCGCGGTGGTGATGGTATCTACGATGTGCAGAGGACACGTTCAGGACCTCCTCTTCCTCTTCTTCTTGTCCTCCG
ACTTGTCGCCTGCGTTCTTGAGCATGATGATGAGGATGCGGACGAGGACGGCGACGAAGTCGGTGAAGAGGGTGAGCGCGTGCTTGATGTAGTCCATGTC
ACCGTGGTGCGCCCTCTCGATGATCTCCTGCGTGTCGTACACCATGTACCCCAGGAAGATCAACAGGCCAAAGTAGACCTCAAACATGAAGCTGCCAGAG
GAGTGGCCAAAGATGGACGTGGCAAACTGCAGCCAGAGCAGGATCGACAGGCCAGAGGAGAGCAGGCCGCCGAGGTACAGGTACTCCCTGCGCTTGGCGA
TGATGGCGGCGCCAGAGAAGCACCCGAAGGCGATGGCGGTTCCGACAAACCCTGTCACGAGGATGCTTGGGTCAAAGTCTATGGCAAGCTCAATCAGAGG
TCCAACTGAAGCCCCTTCCAGGAGGGCTGCACCCATCAGCAGCCCAAACCTCTTCCTCTCCTCATAGACTGGCACCGAGAACATCCAGGCGATGGTTCCG
ATACACGCGAGCATTGTCAGCATCCCGCCAATGTTCAGGGCAATGTGCAGGTAAGCACCCACGGCAGATGAGGCCAGGGCAAAGCATAGGGTCAGGTAAA
CGAGCTTGAGGTGGGACTGCACGGCGGGGGAGATCTCGCGGAAGTTCTTGAGGGAGTCGTAGCCCCATCCGCTGGCCGCCGCCGACGAGGTCGAGTAGAA
GGCGTCCATCCCTGCGCTGCGCCTGCGTCTGTCGAATCGGAGCGGCCTCGCCTCGCACGCAAGGTTGTTCGTCCCTGTCCTGCGCTCGCGCTTTCGCGTG
GATTTTTCTCTTTTTCTTTTCTTCTTCTTCGGCTGGT
page-top