Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11456  (registered. 2007)
Contig Information
Length 796 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06386 [Oryza sativa Indica Group]
Score 1041
Evalue 1.91212e-111
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11456
GTACACATCTGGAGTGCTCAGTCAAACCAGCACGACAGGGAGGAGGGCCGCCTACCTAGGGTTCTAGACTAGCCGTCTCAATGCTTGTGAGCGAGCTGCT
TGAGAACATTGCCGAGGTCGGCCTCGCCCTTGGTGCTCTTGACCCACTTGGCCTTGATCCTCACCCTCTCGATGCTCTGCTTCACCGTCCTCGCGATGCT
CGCCTTGGTCCTGCTCTTGAAGAACTCCTCTGCCTCGTCACCCTTCTCGTCCGTGGCGAGCGGTGAGACAGTGACGGTGATGAAATAGGTGAGCAGGTGT
CCAGTGAAGGTCTCTGCTATGTAGTCCCAGTTTTCCTTCAACCATGTCCATGCCACCTCATGCGCTGCTGCAGTCACTCCGCGGAGCACAAATATGCAAT
CCTGATTCCTTACCTCAGACGATAGCAGGAAATTCAGCGCTTCACGAACAACATCAGGGTCAGGGGACGATGCCAAAGAACCAAGCACACGGACTTTTTC
CTGGCTCAGATCAGTTTCCCTGTAAATCTTCAGGAGAGATTCATACCCACTTTTGTTTGACTTGTTCACGGTCTGCATCAGTGCAACATATGCAGCCTTT
CGGACATCTGGTGGGAGGAGTGGCGTCTCTCTGTCTTCCAGAAAGACATTAAATCGACGGACAGCCTCGTCTATGGTAGACTGATGGCCTAGTTCCGCTA
GAGCAGATAAGAGGGTACCTCTTAACAGTGCATTCAGGTGACCCTCCCCACTCTTGGCATCCCAGCCAACTCTCTGTGCGAATGGCTCAAGGAAGT
page-top