Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11424  (registered. 2007)
Contig Information
Length 525 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Cryptosporidium hominis TU502] >gi|54659709|gb|EAL38275.1| hypothetical protein Chro.70210 [Cryptosporidium hominis]
Score 77
Evalue 4.44035
Total Hit Count 5
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11424
TTTTTTTTTTGTAAAAAGGCCTGCATATATAGCACTGGACTTTATCTTATTCACTGATACAGGACAGGAGGTAGCCTTACAACAACATGAGCAGCAGCAC
AGTAGCTTTACAACAACATGAGCAGCAGCAACACTTATTGCTAGTACTATGCACGATCGGTGCCTTGTGGGCACGCTAGCTGCGTCACTTGACGGAGCAG
TGCCCAAACTTGCCAATCCACACTTGGCCTTCTGGGCACGCTATCTGGGGCGACACGAGGCTGTTCCTCGCCACCGTGGATTCGTGATCCACAAGTCGAT
GATCTCGCATACACCTACAGACTCCTGAACTACGAAGAACGTAGCATGTCAAATGATAGCCATCTGGACAACCATGGGAGTTGGGAAAGAGGCGGCTGGA
GTCAACGGTGCCTTGATGCGCCAGCACCAGCGCCAGCACCATGATCGTAGCAATGCATGTCTTTGTGGAGAAGAACCATGGCTGTCTAGCCTGTCGTCCT
CTTCAGGTTAATTTATGGATCTCTT
page-top