Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11290  (registered. 2007)
Contig Information
Length 864 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit innexin, putative [Ixodes scapularis]
Score 88
Evalue 0.709602
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11290
CATCGATGTCTATTTCATAAAAATATCACCTGCCCGTACAATGAACGCCCCATAGGCTATATATAATAGCCGGACACTAATTGGCCTATTGCCCTCTCGC
ACACACGCTTATAACAAGTCTAAAAAAAACAAATATATCCCTATACGACTTACACGGCCAAACAATAAAATAAAAGGAAACTTTAACCTAATTTGGACTC
TACCATCGGGATGATTATGGACTCTAATTGGATTGGTGCGCCATGCATCTTCTAGTGCATCTCGATCTTCAGGTGGACCCCAACCGACTTCTTTCAAGGA
AAGTAAACGCCATGCATCACACGTCCTGCTCGCTTCTGCCTGGAACTTCTCTTTGTGTGGGAAGAATAGAAATAGGAAATCTGCAACCTTCTCCTTAATG
CCTTGATCATCTATTAATGAACATGAACCTTCGTGTGTATCATGCAAACCAAGCCCTCCAAAATATTTGTACGTGCATGCATTTTTGCCTGGAAACACGT
AGAATTTCTTGTCCTCTCTCAGCCCTTCTAGCTGGAACCATGTAGTGTGCTTCACAGGAATAACGAGTAATTCTTGTTCATCGTTGTAACTTGTCATCAG
GTATTCCGATGTATATGTAGCGTATTTTTGGACAACACCGGCTTCAGGCAAAACAACAATGACCTCGGTATTTATATCACAAGGGGTCATATCAAAGCTG
GTATCAATAACACGTATTCTTTCATGCTCAAGGAACCCGTCTCGATGTCATACTTACTCTTGTGCCCATCCATGCCATCATAGAGGCTATCTTCTTTCAC
GTTAACATGGACGCTCTCCGCCATGCCACGCCCTATGGTTGATGATTCTCATGGTTGCATACAC
page-top