Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10642  (registered. 2012)
Contig Information
Length 908 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_VSCB Liquid cultured tissue 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242047492|ref|XP_002461492.1|| hypothetical protein SORBIDRAFT_02g003490 [Sorghum bicolor]
Score 281
Evalue 7.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10642
TTTTTTTTTTGATAGTGAATATGGACACGAAATTCTTTGATGCAAAATAACATAGGACATTTGTAACATTACAAGTCAGCCTACTGTCCAGATGGCAATA
CTGGGTCATTTACTTCTAATAATCTGTTACAATTTATAAACACATATGCCGAAAGAATAAACAATGGTACAGTAAGTTCTTGACTCTTCCCACGGTGCTT
CCACATTGTCATCCGCCCACCATCACTTCTAGCCAGGGAAAACGAGCATAATGTAGCTGCCGAATAGTTATTTGTTGCCGGATGCACTGCTCGACAGGGC
ATCATATGGAATGTTTAGGCCATCACCTACCTACCGATGAATCCAAGCCGCTGTAGGATGAAGGCCAAGATCAGCATGACAATAGCAAGGACCAGGCCTT
TCCTGCCTAGGAGCCAGTTCTTCGTCTTCTTTGCTACTTCTACTCCCTGCTGTGCTCTGTCCATCCATTTCATTATTCTGTCTAAATCTTCTGGAGATAA
TGAAGACATAGTTTGTTGAGCTTTGGCGGCATCCTCCTTCGACAGCTTCATGCCAAACTGCTCACTCATGTTTGCCATCACATCAGGACTCATGTTCTTC
ATCAGGGATGCAAACATCTGCCGCATAGCAGGGTCTTTCATAGAATTTCTCATGGTTTCTTGCATATCAGCTGTAGAAACTGGGGAACTGGATGATGAAT
GGTCCATACTTTGGTTGTTTACTATTTCATCAGGGTTCTCCACAACAGTTTGTGAAGATGAAGGTTGGAAGTTATTGCTACTCGTTTCTGCTCTTGATGA
AGGTCGGATATTACTCCCAGTCCCTGGTCTCACAGGCGCACTACCAGGTCCACCCATTTTAGAAGCAAAATCCATCATATTTTGCAGTTCAGCAGGGGAC
ATCTTCCC
page-top