Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11197  (registered. 2007)
Contig Information
Length 838 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit temperature stress-induced lipocalin [Triticum aestivum]
Score 891
Evalue 2.23266e-96
Total Hit Count 493
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11197
GAGTCTGATTTATTTATTGGACACCATAAAGATTAGCTAATACACCTAAGATACAGATGAACACACATCATGGCTGTTACAGTGCCGGCCAACTGCATAT
ACAGACGGATGAATCTATCATTTACCAAAGAGCGACTTGAACCACCAGGTCCCTTTGCTGTCGGTGGGCGCGGCATCGCTCTCCGGCGGCGGGTCGCTCT
GCGGCGTCTTGTGCAGCTTGGCCACGTCGTAGCCTTCCTCCTTGGCCTTCTCCAGCAGCTGGTTGTACACCTCCTCCTCGATGTGCGTCTTCCTGCACAG
GATCTACATACATGCACACGTACGCATATGGCAAACAACCAGATTAATCAAGCGCACTTGTAGCGTCGGATATGTGCGTTGTTAGTAATATACTATGTGT
ATGCTTACCCATAGGCTTTTCCGGCGGGGCTCGCCGACGAGGGCATACTGGTAGTCGTCGTCGACATAGAGGACCCAGTAGTCGCCGACGACGGGGATGA
TGGGGAGGAAGGGCGGGACGTAGAACTTGACCTTGAGCTTGGCCTCCTCGCTGGCCGGGTCGGCCTTGTAGGCGGTGCCCTCGATGAAGTCGCGCTTCCC
TTTGCTCCACGTCTCGTTGAGCACGTGCACCGTGGCGCCGTCCTCCATGAGCTCGTAGGTCGCCCGCGTGTCGCGCCCGTCGCGCGGCTGGAAGAAGTTG
GGGAAGGACGCGATCTCGTACCACCGCCCCATGTACCGGGGCAACGTCCAGCCCCAGCACCACGCCCATCTCGCTCCCGCTCTTCTTGGCCGCCATCGTC
TATCGCCGCCCGGTCGCTGCTCGGTCTGTGTCTCGCTT
page-top