Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10628  (registered. 2012)
Contig Information
Length 764 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_SHC Shoot grown with cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|294463738|gb|ADE77394.1|| unknown [Picea sitchensis]
Score 338
Evalue 5.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10628
TTTTTTTTTTAAACCACCATGGGATGCCAGAAATGTATGATCTAAGTTTAACATCTGTTACATCACCACAACCATCATCAAAACCATAGTCTCAGTAGCA
CCACATACAAACAACAACATAGTAAGGAAGACACATAGGGAGAAAAATACCGCGCCTCCCTTCACAGCAAGAGCCAGTACCAAAACATGGCCCCAAAATT
TAGAGCTTGTCCTCGAAGCCCCAAAATTTAGAGCTTGTCCTCGAAGTCGGATAGGGGGGTCATCTGCTCCTTGAGACCCTTCCTCTTGCGGATCTCCGTC
ACGAGCGTCGCCGACTGGGTGCCAGGGTCCAAAGGATCGGAGGCCATGACGTCCCAGTGGTCAAACACACACTGGGGGAAGGCCTGGCCGGACGTCGCGG
CCCTCAGGGTGCTCGAGAACCCGAAGGACTCGATAACAGGCAGGTAGGCCTTGATGTTGTAGAGTGGGGTACCTTGCCTCTGCATCTCCTCGAACACGTG
GCCTCTCTTCTGATTCAGCACACCATAGATACCACCAAGTGCGTTCTCCGGGGCCTGGATCTCAACCAGGTACACGGGCTCCAGCAGCCTTGGCTTGGCA
GTGAGCTGAGAAGCGTAAATGACCCTCCTCGCCGTTGGGATAACCTGACCACCACCCCTGTGAATAGCATCAGTGTGGAGAACAACATCACAGACCTCAT
AGCAGATACCACGCATGTTCTCCTCACACAATGCTCCTTCTTTTGATGCCCACTGGAACCCAGC
page-top