Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10626  (registered. 2012)
Contig Information
Length 1298 bp
Clones alternative view 60 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 7
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_SP 2
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|544242|sp|P36183.1|ENPL_HORVU|ENPL_HORVU RecName: Full=Endoplasmin homolog; AltName: Full=Glucose-regulated
Score 676
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10626
TTTTTTTTTTATACAAAAGGGACTTTTAATTCTAAATGATGAAACCAGGCATGCTAATTTGAGCTAGCTAGGGTATCATTGATGAAAAGACTAGGTACAG
TAGTACATTACACGGACAAAAACCCCGTATCATGATGATGATTAAGCGTTTTCGCGCGGTAAAAATGGACGTCCCTCGAAACCATCACATTTCCAGTCCA
ACACACCTCTAGTGAGAGCTAAGCAGGCGATGAGAATACAAGACGGCGGCCTACAGCTCGTCCTTGTCGTACTGCTCATGCTCCGGCTCCTCCGCCTTGC
CCGACTCCTCCTCCACCTCGGGCTCCTCCACCTCCTCTTCCTCCTCCACGGCCGCGTCCGGGCTCAGGTCCAGGCTCTTTTGCACCGACCGGTAGATGCT
GGAGGCGAAGTCCTTGGGGTCAGGCAGGTTGAACCCGCTCTCCATCAGCGCCGTCTGGTACACCAGCCTCGCCGTCTGCTTCAGGCCCTCGCCATCGCTG
TCCTGGGCGACCTTGTCGCGGAGCTCCTTGATGATGGGGTGCCTGGGGTTGATCTCCAGGACCCTCTTGCCGCGCATGTAGGCCTGCTTGCTCGCGTCCG
ACAGGGTCTGCGCCTGCATGATCTTCTCCATGTTGGAGCTCCACCCGTACTTGGAGGTGACCACCACACAGGGGGTGTTGTGCAGCCGGTTGCTGATCTT
CACCGAGTCGATGCCCTCCGTGTCCAGGGCCTTCTTCCACCAGTCAGTCAGCTCCTTGAACGACTCCTTGAGGTCCTTGAGCTTCGAGTCCTTGCCCAGC
TTCAGGCCCTCCTTGGACACGTTCTGGAACTTCTTGTCCTCGTAGTCCATGAGGTATTGCATCAGGTACTCGTCCACAGGGTCGGTGAAGTAGATAACCT
CGTAGTTTTTCTTGGTTAGCTGCTCGAGGAATGGAGATTTCTCTAGCTGCTCCTTGCTGCTTCCTGTAAGGTAGAAGATGTCCTTCTGCCCTGACTTCAT
CCTTGAAATATACTCATCAAGGGAGACAAGTTTGCCATCTGACTTGGAACTCTCAAATCTCAGAAGCTTCGCAAGACGGTTCCTGTTTGTTGCATCTTCA
ATGATTCCAAGCTTGACTGATTTGCCAAACTCGTTCCAGAACTTGGCATACTGGCCCTTCTTCTCCTCCATTGCACTCTTCTCATCATCTGTCTTTTCTT
TGTTGCTGTACTCATCAGGATCCTCCTCAGCAAGTTTCCTAATCATGTCAAGAGCCTTGCGGATCAGTTTCTTCTTGATGGTCTTCAGACTGCTATGT
page-top