Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11098  (registered. 2007)
Contig Information
Length 866 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0114100 [Oryza sativa (japonica cultivar-group)] >gi|42409291|dbj|BAD10553.1| unknown protein [Oryza sativa Japonica Group] >gi|113622816|dbj|BAF22761.1| Os08g0114100 [Oryza sativa (japonica cultivar-group)] >gi|125559935|gb|EAZ05383.1| hypothetical protein OsI_27588 [Oryza sativa Indica Group]
Score 176
Evalue 5.42597e-14
Total Hit Count 83
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11098
CATCATTTATAGGTACATTTGGTCAAGCAACCAATTAGCAGAAGAACAATAACATTTCTCTATATCTTGAATGCTACATATGGGATAATTAATATATCGA
CTTGTATGGATGGCTTCACTCAAAACAATACATATGCCTTCTGTTTATTTGCCTGACAAATGGCCATCAGATGAATCAATCAAATAGGAGGAATCAGGGA
GCATTTCAAACCAAAACAAAGAATTTATCCTAACTACTAAAGTGCAGCAGCTTTAAAGCCTCTGAATTATTTTGCTCCCACTCCACCAAGAAAGTGCAGG
CCTTCAAGAACCAAAAGATTTAAGAGTGGAACTAAAAGAACAGCAGTCCAAATCCTCGTAAGCCATGTTGTTTATATCCTTAAACCCAAAAGGTTGCCTC
TTAGCATCTCTGTTGTTCTCTTGGTCCTTATTAGGTGTCAGATTATCAGCATGGCCATCTGAAGTCCACTCAATGATATCCCATTTGATTTTGATGTTCC
TAGTTGGATCAAGAGGGTTGTGCTTTACCTTGCTAGAGACGGGATGCCCAGGAGGAAGCGACTGGAGGCGGCAGCGGTGAATCCAGGCAGCAGTTGCGCA
AATACGAGACATGCATTTCATCAGTTGGCAATGGAAGCATCCATCATATTCATACATACTTGTGTTTCTTTATAAGCAGTCCACTTCTCCGCCTCACACC
ATTGACTTCCACCTCAATAACCTCTAACGGGCCGATGAGCCATTGGAAGAAGGGGATGGTGAGGGCAGCGTTGAACACCTAGGCCCAACGCCGGAAGGGA
GCATCCANAGGAGCACCTCACGGACGGCCTCCTGCTGGCTGCGCGTGCAANCACCTCACATCCCGC
page-top