Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10623  (registered. 2012)
Contig Information
Length 1136 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218189631|gb|EEC72058.1|| hypothetical protein OsI_04970 [Oryza sativa Indica Group]
Score 477
Evalue 1.00E-132
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10623
AATCAACAAAAGAAGGGTAAACTGTAATAATGACAGTTACACAGCTCACCGCAGTGTCCTAAATCCCATGTGGAAGCGCCAATGTCAGCACTCCCCTTAA
AAAGAGTCAAAGATGACACGCAAAGTATTCCAGCCAGGGTGCCTTGCATTCACAATATTTCTGCTCCAGCAGCAGTCAAAATTGATTTCTCCATCTTCGA
ACCCCACAAGCATGATGGTAGGGCAGGTTACTAGCACACTGCCTGAATAAATTTTGCCAGGGATTTGTAACCACCAACATTGATATGAACATCCCTTCAA
ACATAGACAGTTTGATCAAGCATTCAATTTTTTCCCTTCAAAGAAATCTGAGACCTGGTTCTCCACATCCTCAGGGTTGTACTTTATATACTTTGCGAAA
TTCCTTCCACCCTCTAGCTGCCCTCGGAACCTTCCAACAAACGAACGGTATGCTGGAAGGACCTTCTCCGAGATGGAAATCTTCAACTCTTCTCTTAACT
GAGGATCCACAACCTTCCATGCTGTCTGTGTCCTGTATAACTCCTCGTAAGCCAAGTTGAAGCTCTTGAACCTTTCCTTCAGGGCAGCCTTGAGTGCACT
CGATGAACCTGTTGTCTGTGGCAACCCATCATCCCTCAGGCAAGCTAATACCCTGGTCCATGAGGATCGGAGGTACCCTGTAGAGTACCTCCTAATCTGA
CCCCGGCGCTTACGGATCCAGTTATCCCCAAGCAAACTCTTAAGCTCTGAATCCTTGATCTTCTGCACAACATACCACAGATTGTTCATCAAAAATATGT
TCTGCAGTGCCTCATCATCATACAGCTTCGCTTTATCCTCAATCTTGTCCAATAGATGTGTGATCAGTATGAGCAGACAGTGACCCAGTGGAGTCATATC
CGCATTGTCGCCCCCATTTTCCAGTTCAGTCTCGCAACCATCAAGAAGATGATTCAGCCAGCGGCTGTAATCTGCAAGTAGTCGCACATAATTCATGACA
TAACGCGTAAGCGGGTGGATCTCGCCGCCTGGCAGTGATCTGCGAGAAGTCTCCCCACGTATCGCATTGGCAAACTCGGTGACCGTGCCACGCACCGCAT
CCCCTAGCCTGACCAGTACCCCCTCTGCCTCTTCCT
page-top