Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10620  (registered. 2012)
Contig Information
Length 953 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 2
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115474531|ref|NP_001060862.1|| Os08g0117400 [Oryza sativa (japonica cultivar-group)]
Score 285
Evalue 5.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10620
ACTGGCGCATTTCACTGGTTTCTGATGAAGCAATCAATCAATCACAGAAAGTAACAGGATCCACACTTTACATTGCAATACCATCGGACAGATCCATTAA
TCCATAATCACACCATTTTTATCCATAGGCTGTATTAACATCAATGCATAAACTGGCGCATTTCACTGGTTTCTGATGAAGCAATCAATCAATCACAGAA
AGTAACAGGATCCACACTTTACATTGCAATACCATCGGACAGATCCATTAATCCATAATCACACCATTTTTATCCAAACCCTAGGGCAGTTGGGGAACCA
CACCGAAACCAAAGCACAAAACAGAAGCGCAGCAGATCAGATCAGATGATACGAAATAAAATCACGCGAAGAAGGAGTTATTAAATACGAAGAAGTCTGA
GCGGGCTGGGATACGGATCAATCCACTACTTGGCGACGATGCGGCGGATGAAGTCGTCGTAGCGGATGGTGCCGTCCGCGGCGACGTCGACCTCGCGGAT
CCACTCGTCGAACTCGTGGGGCTCGAGCTTCTCCCCGATGGAGGTGAGGACGTGGCGGAGGTCCGCGACGGAGACGGTGCCCGACGCGTCCTTGTCGAGG
ACGCGGAAGGCGTCGCGGAGCGGGCGGTCGAAGGGCTCCGGGCGGAGGTGGGCGCGCATGAGTTCGAGGAATCGCTTGAAGTCGAAGGGCGCCGTGAGCT
TCTCCTGGGCGGTGATGTCGCGGAGCTGCGCCTGCGTCGGGTTCCCACCCAGGGAGCGCATGAGGACGCCGAGCTCCGAGGGGGCGATGCGGCCGTCGCC
GTCAGTGTCGAAGAGGGAGAAGGCCTCCCGCATCGAGGCAACCTGCTCCTCGCTCAGCTCCTTGCCGGCCATCGCCGCCGGTGGGGTCGGATCGGGGATT
TGAGATCTCGCGACGCGGGGCGGTGAGGTGAGGTGCGGTGCGTGCGTCTCAGG
page-top