Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig11043  (registered. 2007)
Contig Information
Length 727 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_002025 [Oryza sativa (japonica cultivar-group)]
Score 741
Evalue 9.80308e-77
Total Hit Count 154
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig11043
TTTTTTTTTTGGCAAAATATGTCAATGTTCATCACATAAGCCATGCCACAAAAGGTGATTACAGATAGTCATCAAGCACTTGCGTGTTAGCATATACATT
CTGGGAAATTCCGATCAATTTGAAATGGCATCAAATACATGATACATAATGCAGTGGCAGCGTAATAAAACATCAGAGATTACTTCACAAGCGGTGAAGT
CAGAATGTATATGTCGATCTCATCCAACGTCGGGCGGTCGCGCAGCGTCAAGCTGTGTTCATTTGCCAGATGCAAGAGACAAATGAAATAGAGGTGTGGC
GAGATTTCAGTCGTTGAAACATCTCTGTTACTGCATGGAAGATCATGCAGTACCTTCGTCAGGCACAGAGACGGTTCTATGTCATCTCTTTCCAGATCAG
CAGTCTTAGCAGATGTATGAATGTGATTCCAGAGCACTTCCTTTAAGGCATGAACATCGACTTGTTTCGATACCTTGTCATATTGTACATCAATCTTATT
GACCTGTCTTGGTTTGGCAATAAGATTTACTGGCTCTTCCACATCGCTAGCCGCATCCCCTTCATCAACATGATCATTGCCCAGGTTATCATCATCCCAA
GGTCTGGATGGCATAAAGTCATCGCTGTTGTCCCTTGAATCATCAAGTGGTTTTCTTCTTCTTCGAGCCAGACACAAAATATCTGGAAGAAGAAATAATT
TAACAAGGCTTTCAGGTTGGTAATGAC
page-top