Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10901  (registered. 2007)
Contig Information
Length 784 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0004N05.14 [Oryza sativa (japonica cultivar-group)]
Score 1091
Evalue 2.97645e-117
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10901
GAAGGGCATCGTCCATCCATCACCATGGCAACACGGCCGGGACCTTTGACCGAATGGCCATGGCAGTGCATGGGAAGCTTCAAGTACCTGGTCTTGGCGC
CTGCGGCGTTGCACACTGCGCACAGGGTGGTCACCAAGGGGTGGGGAGACATGAGCCTGGCATACGCCGCCATATTACCAGCTCTGCTGCTGAGGATGAT
CCACAACCAGATCTGGATCAGCTTGTCTCGCCACCAGACCGCACGCAGGAAGCACATCATAGTCGACCGTGGACTTGAATTCGACCAGGTGGACCGGGAG
AGTTCCTGGGATGACCAGATCATCTTCAATGGGTTGTTCTTCTACCTGGCCTACGCAGCTGTCCCGAATGTCAGTCGCATGCCCGTGTGGATAACAGAGG
GAGCCATCATCACCGCCTTGCTTCACATAGGACCTGTCGAGTTCCTCTATTACTGGTTCCACAGGGCGCTGCACCACCATTTCCTCTACTCCCGCTACCA
CTCACACCACCACGCCTCCATCGTCACAGAGCCCATTACCTCTGTCATCCATCCATTTGCTGAACATGTGGTTTATTTCCTGCTTTTCTCGATCCCCATG
ATGACACCAATTTTTATGGGGTGTGGTTCTGTCCTGGCTGTTGTCTTGTACATCACGTACATTGACTTCATGAACAATATGGGGCACTGTAATTTTGAGC
TGGTGCCAAAGCACATCTTCCATGTCTTCCCTGCTCTCAAGTACCTCATGTACACTCCCTCGTTTCATTCTCTACATCATACAC
page-top