Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10784  (registered. 2007)
Contig Information
Length 802 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit class I alpha-mannosidase 1A [Aspergillus clavatus NRRL 1] >gi|119396433|gb|EAW06865.1| class I alpha-mannosidase 1A [Aspergillus clavatus NRRL 1]
Score 81
Evalue 4.0212
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10784
TTTTTTTTTTGGACGAAAACAAATTTTATTTATCCCAGGATGATTGCAAGGTTACAGCACTCGACCACACGCCTGCAAAAACCGGGGATCTGGAGACAAA
AAACAACCACACAAGGTTGTCATGGCAAGGGTCCGGGGATATGTTGCACCTTGCCAAGGCCAGATCCCCGGGGATATCAGGCAACCCCTGCAGATGCTGC
AGAAAAGCGACCATCCACCGCCGACGACACACACGCACAGCACACACACACACACACGCTACAGACCGTGAACAGACTGAAACTGGAACAACCACACACT
GAAAGAGATCGTAGCAGACACCTAGACACGGATCGAAGAACCGGAACCAAGCTTCTACGACAGGCACGCACCCCGACAAATCCGACAAATAGAACTTGCT
ATGGAATTGAAACCAGAAGTACTGATGTCCCACAAACTCTGGAACCAGATTGTACTGGAAAAGAAGACACAACTGACTGACAATATTTGAGCTCCCACAC
AGGACTTGATAAGGAGAGAAAAAAAGAAGCATGGTGTAGGGACTGTAATCACAAGGGCATAGGTTGGGGGTAGAGGGACAGGGTGCCACGCTAATGGCAG
CCGAAGGCTCAAGGAACAGGCATCCTCGCGAGAGGAGGNCTGCAAAAAACGAGCGCTTGGCTAAAGCGTCCCCCGGAAAACAACCGACCCTAAGACAAAG
GAAGCCCACCATGACTCAAACGCGCAACCGACGAACCGAACCGACTCTGCTATGAGGCTTGACTGAANAAGTACTACCTACGGTCGTATATTTGCATCTG
GA
page-top