Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10718  (registered. 2007)
Contig Information
Length 1062 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0668200 [Oryza sativa (japonica cultivar-group)] >gi|113537216|dbj|BAF09599.1| Os02g0668200 [Oryza sativa (japonica cultivar-group)] >gi|125583194|gb|EAZ24125.1| hypothetical protein OsJ_007608 [Oryza sativa (japonica cultivar-group)]
Score 213
Evalue 3.1712e-15
Total Hit Count 104
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10718
TCGGAAGTGTTCACATGAGCACGACATATAGCAAGCTGGCTACAGCTGCGACAATAACACAGAAAGACAAACCAAATCTTAAAACCTACATTAAGCTAGG
CTTAGCAATTCGTTGCCCGGTCATACAATCTTTTCTTCCTGGTTAAACATGGCTAATGGGACAACATGGTTTACTGTTAGCGACTTCCTGAAGCTAACAG
TGACCACATCCAGAGTTACAGACATAGAACATATGCATGCTTCAGTGACACATTTGCAAAATGTGAGCTCCTGGAAGCACCAAAAGTCGAAAACCTCATC
GCCTATGAATATCACTGCCATTTCCAGCAAGAATGTAGCCAGCTGAATGACTTCACATAATTATTCCAACATCAAATTAGTGAAACCACCGCCCCTACTT
ATCAGGAACCTTTTGGATGCTATTTGCCCTCTTCTTCTTTTGGTTCACTGTTTGCTCTGAACCCCTTTTCAATCTCTTACCACTCCCTTTTGTGTTTGCT
ACATCTGGTGGATGAATACTGATCACACTTGGGAATGATGTTTCGACGAAGGATTCAAATTCTTGAACTTTACTTTGCTCACTAATGGCACCCATCTGTT
CCAATTGCGTGAAGGCATCACCAACAACCTTGTGAAAATATCTCATTTTCTCCTCACAATGTTTCGCTGCATGAAGTGCCAAGCTAAATTTTGAACATGT
TTCCGAGTACAACTTTTTTATGGTAGGTGAAAGACATGTAGATGGGCCTTCTAGCTCATGTCCGTNGGCGTCATAGGAAAGCTGACGTGCTGCCATTTTA
GTCCACCTATGCAACACATATTGACTAGGAATTTCATTACACTAAGCTGACGTGCAGCCCACATTTTCCGGACCCCCCGTCTCTACACTAAGCAAGCGAT
ATGCTGCAGATGTGCCAACCATTGCTTTATGACATGTAAGTAGTTTGCTCCTCAACTCACTACTTACTTCCCTATTTGACTTGATGAGATGTCTCTTACT
TGGCGAAATAAGTTGGTGAATGTGTGATTGAACAAACCGGGCAACCTTATATTTGCCATCAT
page-top