Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10584  (registered. 2012)
Contig Information
Length 1052 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 1
Wh_SHC Shoot grown with cold treatment 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222636924|gb|EEE67056.1|| hypothetical protein OsJ_24005 [Oryza sativa Japonica Group]
Score 235
Evalue 8.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10584
GCCCAGCTGCATCTGAGTTTGTGCCTGGACCAGCATGGTCAAACAATCATCCAGTCGCTTACACCCCCAGCCCACATGTTGCTGACACTATTTCTCAGTC
AATAGCAGATTCACACGTCCTATCTGATGCAGCTGTTGTTAGTATAGGACCTTCACTGGACAACAATATGGTTGCAGTAAAGGAGGAAATGGAGGTCCCT
GTGGAGGTAGACAGTGGTAATTTGATCCGCAATAATATTTTGGGAGAGGAACATGATAAAGGGTTGAAGGATGCTGTTAATGCTGCACTTAATCCTCACA
CGCCAGGAGACAGCATATTTGATATTGGTGGAACGAAACTGGGGGGCAACATGAAGAATGAAGATGAGGGTAGCTTTAGGATATTTGTAAAGGGGAAAAG
CAGGCGAAAGCAAACTCTGAGGATCCCGATAAGTTTGCTTAACAAGACATATAGCGCACGTTCCTTCAAGCTTGACTTCAACAGAGTAGTCAGAGAGAGT
GATATCTTCAAGCCATCGGGCGTTTCTTCTGCTGAAGTAGTTTCTTCTGGCGACTGAGGAATATTCCACCAGTCAAATATTTACCTATGACATTATTACC
CAAAGAGAATTCGATGGATCTCCATTTGAAAAATACTGAAATGTGACTCTTATTTTTATCTGAGCATTCGGAAGGCAGCAACAATGCTCCTTCAGTGTTC
CAGATTTGATCCAAGCTACTCTGAAAAGATAAATGTGTTTTCTTTTCCGACTTCAAATAAGGTGTCGACAATTCCGTGTGGAGTGTAGCAGATTGCCGAG
AGTTTTGCGAGATCCGGAACCAATAAAAGGTGGAAGTGTTAGCAAAAAATACATGGCAGACTGATTCTTTGCTACAATTTTGATAGACTAAGTAGAATAT
TTTCCTCCAAAATTTTGGCTAAATTTTGGTCGTATGGAACTTAGCTTCTAGAAACTTAGAAATTTGTTTGCTCCTGCATCCTGAAATAACCTCTCGTGTC
TTTTGTGAGAGAAACTAATGTTATTCTTTTGATGATGAGAATAGTAATAAGA
page-top