Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10687  (registered. 2007)
Contig Information
Length 785 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34040 [Oryza sativa Indica Group]
Score 381
Evalue 6.3519e-35
Total Hit Count 343
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10687
CGAAGGAAATACATGGAACCCTGATTCATCAACTGGGAACATGATACATAGAGTGAGTGATAACATGGTTCAGCTGAATACACCATCCATTTGGCGAGAC
AAGCTGACTAACATTGTTGCATCATCCATATACCTAGTCACCTAGAAATATATGCGTGAATCATCTCACTTCTCAAATCCGGCTCATTACTACTAATCAT
CCCACAAGTTTTTAGTAGTGCTACCACATCATTATCTCACATATAAGTTTACTTAGTAGGATGAAAGGGTGTTATCTCTCCATCAGGCCATGAGGTAAAG
ATCTAGCCATCATTGGATGAACCAACGATAGTGAGATCTGCCTTCACAACGCAGCTCGATCCTACAACATAGCCTCCCGACGGATCCTTGAGTTTCTTGA
GTCCAAGGAAGTTAGGCCATCCCCATCCTTGTCCACATACCCAGAGACCTGAAGTTCTAGTGAAGTGTTTCCCATTCTTTTGGTCCAGGATGGACAGAGT
CATTACAGCCACCTTCTTGGACTCGAGTTGGAGCTCATCCGAGGCATCCGGGTATAAGTACAAGCTGAGGCAATCGGTGCTGTACTTGTCACCACGCGGA
TACATGCCGATGTACCAATTTTGTCCGCCAACTTCAAATGTAGGAGACTGGATGAAGTGCTTCAAGTCCAATTCAAGGAAATTGTTCATGGTCCAAGTGT
ATGTCCCTTTGATGAATCCCTTACTCTGGACAAAGAGGTTCTGAACTATGGTAGCCTTCTTCTGAACCACAACAGCCTTCTTTTC
page-top