Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10575  (registered. 2012)
Contig Information
Length 1261 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_RDr Root of dessiccated seed 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115461330|ref|NP_001054265.1|| Os04g0677500 [Oryza sativa (japonica cultivar-group)]
Score 521
Evalue 7.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10575
TTTTTTTTTTGGAGATACGCATTGTCCTTGAGCTTCCGACTCGACGATGCCAAAATCTTATTATCACCACATGTATCGACATCACTACCAAACCAGTACT
TGAGAGTTCAGAGTACAACAAGCAGCAGCAGCAACTAATAATAATTAGAGAAAAATTTGTGCAGGCATGACACCTGCCAAACACCATACTACAGGTAATA
AAAGAGCTCTATATAACGGAGTCCTCTCCCTCCTAATTTACCAGCTCGGATCGGATCTATGCAACAAACTGCAATACTGACGGTACGGCGATTAATCAGT
TCGTCTCCAGGAGAAAGACCAGAGAGGAACAATGGAGACCCGGGTCTCGCCACGGCAGCAAGGACCGGGGCGGCGCTCGGGTCACCATGCCCGGCAATGG
CGATCACTTGACGGTGCAGATCTTGATGACGGAGGCCATGCCAATACGGTGCAGGACGACGACGGCGTCGCCGGCCTTGCAGAGCTGCTTCTTCACGGCC
GACTTGAGCGCGGCCTGGAGGATCTCCTCCGTCGACTCCGAGTCGGTGGCCTTGGCGGAGCCCTCGGCGAGGAGCGGGATCAGGCCCCTGTAGATCAGGC
TGTGCCTGGCAGGGCCCTCGGAGCTGACGGTCCAGTCAAACGAGTCGGTTGTCAGCACTGGGACGACCACCGAGAGGATCGGGACCCTGGGCCGGTACTT
GGCAACCAGCTTAGCTGTGGTGCCGCCACGGGTCAGGACGACGATCAGAGTGGCCCTGGCCTTGTTGGCGGTCCGCACGGCGGAAGACGCAAGGGACTCC
AGCGGGCTCATCGGGAGGGGCGCGGCCTTGATCATCTCCTTGAAGACGGCGTCGTTGTCCAGGGAAGACTCTGCCTCCACGCAGATGCGAGCCATGATCT
TCACAGCCACCTCAGGGTATGCTCCAGCAGCGCTTTCACCACTGAGCATGACACAGTCGGTTCCATCAAGCACCGCATTTGCGACGTCAGTAGCCTCGGC
ACGGGTTGGCCTCGGGGACTTGATCATTGACTCAAGCATCTGGGTCGCTGTGACAACAGGCTTGCCAGCAAGGTTGCACTTGTAAATCATCATTTTTTGG
GCAAGGAATATCTTCTCAACTGGAATCTCCATTCCAAGATCACCTCTGGCAACCATAAAGGCATCGGTTTCCCTCAGAATGTCATCAAAGTTCACAATGC
CCTCCTGGTTTTCAACCTTTGACATTAACTTGATGCGCTTTGCATGCTGTCCAAGAAGCTG
page-top