Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10564  (registered. 2012)
Contig Information
Length 1082 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_VSCB Liquid cultured tissue 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|45357048|gb|AAS58477.1|| unknown [Hordeum vulgare subsp. vulgare]
Score 532
Evalue 3.00E-149
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10564
TAAAAACCACCTTCATCAGTACATAAACGAACGAACGACCGCGTTGAGTTACAGTAATTAATGGTTCAAGATTGGAGACGAGAACATCGATCAGCAATTC
CACTAACAAATTCACGGAGGGTCAATCTTTACTTTCTCATGCCTCGCTCGCTCCCTCGATCATGCTATCCTAACACCGCATATTTATATCAAAATTCCAT
TGGATTTTATTATTTCTTTCTTTCTTTGGTTGGTTTGGCCTGGGCCTATAGGGGGATGACGTCGACGGCGTCGTGATCGCTGTTGCGCGCTTCAAGCTCG
GCCTTGTTGGATGATCCGTTTTCTGGGTTGGCAGGGGCGGGGGCGTCGCGGTTCTCTGACATGCTCATCTCCTGCACGGGGGGCGGGTTGACGACGGTCA
TGGGCACGGCGCTGTGGTCGGCCAGGCGGCCCCTCCTCTCGCGGTGCTCCTGGCAGTTGGCGCACCAGTGCAGGCAGCAGTGGGTCATGCATGGGTCGCA
TGGGGAGTTCTTGAGATGATATCTCTTCTGGAGTTCTTGACGGAAAATGCCAGTATAGGTACCACACAGCCACCAACTAAACATCAGACCTTCTCCAATA
AGAAATGATGATCTTGGGTCAACACCATGAAATATTGCTGTCAGGATTGCAAGTGTAATCCCTCCTTCCACAAAGATAGCATGGCAAACACAAGGCGTTG
TCCAAGGGATATCCTCTCTGAGGGCCTCAACGTTGCGCCCAAACAGCACGCAAGGACAGAACAATCCAGTGCGACAGCTCTCGGGGTCGTCGGTGCACCC
GAAGATCCCGGTGGACCACGGCTCGTCGGCGGGCGGCTCGTAGCTCTCCGGGAGGACCTGGCCGCACTCGCCGCACCTCCGGCCCTCGAGCTGGGGGACG
TGGACGGGCTGGTTGAGCTCGCCGGGGCGGATGTCCTCGCCGGGGGCGTCCTGGTCCTTGGTGAGCTTGACGTAGCGGGACGGGTGGCCCTCCTCCGCCA
TTGCTTGCCGGCGGCGGCGACCCGGGGGACACTGCTAGACTCGTCGAAGAGAGGCTGCCAGATCTGACCTGACCGGGGAGGG
page-top