Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1056  (registered. 2012)
Contig Information
Length 1309 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 3
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 3
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|270233745|emb|CBI22354.1|| unnamed protein product [Vitis vinifera]
Score 551
Evalue 5.00E-155
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1056
CGTGGCATGCATCATGCTACGTACACCGGTGACGCGCCGGCGGGTGCGCGCCACGTTTTATTACATCACCCGACAGAGGCGGCGAGTGGGTACATGGTAG
TTAAGATACATAGGTGACTGGCGGCGCCATGGACGGGCGGGGGTGGTGGAGCTCGCCGCGCGGAGCGTCTGCCCTAGCACTCCCTCTGGCAGGTGCAGCG
CCTGAATTTGCAGTAGCCGGCCGTCCATTTTGCGCCGTGCTCGCTGAGGCACGTCTTGGTGCAGCTCTTGTCCGAGATGCACGGGAACGAGTGGTGCTGG
CTCTTCCCCGTGCAAATGCGCGCCTCCGCCACGCCGACGCCGCCGCTGTCGCCTCGTGCCGAATTCGGCACGAGGATCCAATCCAGCCCCCCTCCGATCT
CGCCGAGAAGTCTCCGATTGAAGCGAAGCGAAGCCAAGGCTCTCTCCTCCTCCTCCTAAGATGCAGATCTTCGTGAAGACCCTTACCGGCAAGACCATCA
CCCTTGAGGTCGAGTCCTCTGACACCATCGACAACGTCAAGGCAAAGATCCAGGACAAGGAGGGCATCCCCCCGGACCAGCAGCGTCTCATCTTTGCTGG
CAAGCAGCTCGAGGATGGCCGCACCCTTGCGGACTACAACATCCAGAAGGAGTCCACCCTCCACCTGGTTCTCAGGCTCCGTGGTGGTATGCAGATATTT
GTCAAGACCCTCACTGGCAAAACCATCACCCTCGAGGTTGAGTCCTCAGACACCATTGATAATGTGAAGGCCAAGATCCAGGACAAGGAGGGTATCCCAC
CGGACCAGCAGCGTCTCATCTTTGCTGGCAAGCAGCTCGAGGATGGCCGCACCCTTGCAGACTACAACATCCAGAAGGAGTCCACTCTCCACTTGGTGCT
CAGGCTCCGTGGTGGTATGCAGATCTTCGTCAAGACCCTCACCGGCAAGACCATCACCCTGGAGGTTGAGTCCTCGGACACTATTGACAATGTTAAGGCC
AAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGTCTTATCTTTGCCGGCAAGCAGCTTGAGGATGGCCGCACCCTTGCGGATTACAACATCC
AGAAGGAATCCACCCTCCACCTTGTCCTCCGCCTTCGTGGTGGCATGCAAATCTTTGTCAAGACCCTCACCGGCAAGACCATCACCCTGGAGGTTGAGTC
CTCGGACACCATTGACAATGTGAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGTCTCATCTTTGCCGGTAAGCAGCTTGAGGAT
GGCCGCACC
page-top