Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10559  (registered. 2012)
Contig Information
Length 913 bp
Clones alternative view 131 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 6
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 6
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 12
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_SP 1
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 20
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|60100214|gb|AAX13276.1|| USP family protein [Triticum aestivum]
Score 331
Evalue 6.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10559
TTTTTTTTTTGCAATGGACAGCAGAATCCATTTTATTCAGACTCTACAAACTGTATGCAACAAACAGCAGCACGGACTGACTCATGGAGCAAAAGCTAGG
CTGAAGATAAGCACACAAATGTACAGGATGTACAGGACACATGCACAGATTACACACACCTGGGAATCATCCACAGGCTAATTGTCAATTATTATTACAA
ATAACACTGGATGGTTCAATAAGTTGCGGCCAACTGGATATATAGGACTCTGGCAAACTAAAACACATGTGGACATTTGCGATGATGAGATCAGGCATGG
TTACTCGCTGGCTTGACAACGGTGACAGGGCAGGCGGCATTGTTCACGACGTAATCGCTGACGCTGCCCAAGAGCACCCTCTTGAGCTTGCCAAGGCCCC
TGCTCCCAATGACCAGGGAGCTGATGGGCATGTCATGGATGGCTTGGCACAGCTTCTCGCGGGGATCTCCAAACAGGACTTTTGAAACCACGGAGACCTC
CTTCTGCTTAGCTATAGTGTTGAGCATGTCCAGCGTTTCAGCATCAGGCTTCACCCCATATTTCTTTGCAGTTGAAGGGTGAGAGAACTCCGAGAGGGGG
ATCAAAGGCGAGCCGGAGGCCTCCCAGAGGAGGGTCTCGCCCTGCTCGTAGTCGGGGTCCTTGAGGACGTGCAGGAGGAGCAGGTTGTCGCCGGAGCGGA
GCAGGTTGTCCGCCGCCCACTGCAGCGCCGCGCGGCTCCCCTCCGAGAAGTCCACCGCCAGGCCCACCCACCTCTCGCCGTCCGCAGCCATGGCCGATCT
CTTCTCTTCTCCTCGCTCGGCTCTTGGGTGGTGGTGGAGGTCACCGCTGTTTGGAAGGAAAAGTTGGGAGACGCAGGAACAATTAAGGACGACGACGACG
GTGGTGGCCTTCT
page-top