Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10432  (registered. 2007)
Contig Information
Length 1184 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0164600 [Oryza sativa (japonica cultivar-group)] >gi|15528748|dbj|BAB64790.1| putative senescence-associated protein [Oryza sativa Japonica Group] >gi|21327992|dbj|BAC00581.1| putative senescence-associated protein [Oryza sativa Japonica Group] >gi|113531634|dbj|BAF04017.1| Os01g0164600 [Oryza sativa (japonica cultivar-group)] >gi|125569151|gb|EAZ10666.1| hypothetical protein OsJ_000491 [Oryza sativa (japonica cultivar-group)]
Score 757
Evalue 7.84356e-91
Total Hit Count 298
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10432
CCATGGGCGGCTTCCACCGCGTCCCGCCTCTCGCCCCCTTGCCTCCACGCTGCTCCCCACCACCCGCTCCGCCGCTCGCGTTTCTCCCCTCTACGCGCCG
CCAAGTTGGAAGCTGTGTTATCTATTGGAACTCATGTAATCCCACACCCAAGAAAGGTTGAGACCGGAGGAGAAGATGCTTTCTTTGTGGGCGGTGATGG
TGGTGGAGTATTTGCCATTGCAGATGGCGTTTCAGGCTAATCATTCTCTTATCTACTGACAGATGGGCAGAAAAGAATGTCAACCCAGCTCTGTTTTCTC
GAGAGCTTATGGCAAACAGCTCTACTTTTATCAAGGATGAGGAGGTCAGTCAGGATCCTCAAATTCTTCTAATGAAGGCTCATGCTGCAACTTCTTCCAT
TGGATCTGCTACAGTAATCGTCGCGATGCTTGAGAAGACTGGAACCCTGAAAATTGCGAGTGTGGGAGACTGTGGTTTGAAAGTTATTCGAAAAGGCCAA
GTGATGTTCTCTACATGCCCGCAAGAACATTACTTTGATTGTCCATACCAGCTAAGCTCCGAGGCAATTGGTCAAACATCTCAAGATGCACTGGTTTGCA
CTGTAAATCTTATGGAGGGTGACATGATAGTCAGTGGCTCAGATGGATTCTTCGACAATATATTTGATCAAGAGATCCTTGGTGTCATTAATGAGTCTCT
AGGCACAGATGAAGCTGCAAAAGCTTTGGCGGAGCTTGCAAGAAAACATTCAGTGGATGTAACATTCGATTCACCCTACTCGATGGAGGCCCCGGAGTAG
GGGTTTTGATGTTCCTTGGTGGAAGAAGCTACTTGGAGCTAAGCTAGTAGGCGGTAAAATGGATGATATTACGGTCATTGTCGCACAAGTGAAGACAGTG
GTGATCCCAGACGATGAGGGTAGTGGAGTTGAACTGGAGAAAGTGGGTGGTGAGCAACTCGCTGCTGCTGGAGTTGCATCCACTGAACAGAATGAATGAA
AAGGAGTTGTATATATTGAATAGAAATTCATTTTCTTTTCCATTTTGGTCATGTTGTACTATACCGCAGTCCAAGGAAATTGAAGTGAAATGTATACTTG
TGAATACCCATGCGTGTATAATTCCTGCAGATTGGGNTTATTAATACTAGTAAAATTACTCTTTGAATCTCGACTTATGCAGGG
page-top