Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10428  (registered. 2007)
Contig Information
Length 923 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_033554 [Oryza sativa (japonica cultivar-group)]
Score 540
Evalue 3.08422e-53
Total Hit Count 21
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10428
TTTTTTTTTTAGTCAAAAACCTTCCTTCAGTTTGATGCCAAACAATTGTCAGTTGAGCTATAGATGATTGTCACATTTGCTTTCAGTTTTTGATTCAACA
AACCCCACACCAAAACATGAGCTTTCTATGCACCACAAAAGACCTACCAGCGGCAAGTTACAAAATCATGTACAGAGGAGTCTCTCGAATCCCCAAGGCA
AGAAAACATTTACACAGCTACGATGGCGAAATAGAACATACACGCTAAACGGTATCTCTCTTCTCAAGCCAGCTTCCATCGCACCCAAACCATATGTATC
CATATACTTCAAGGACCACCTGTTCATGTATGACTTCGCCTAGAAAGGAACCTTGTGCTTGGAAGATCTAGTTCAAACTCAGGATCATGTCGGCACATTT
GCATCAACTGCCTTCCAGTAGAACTTTCACGTACCAGCTCATAAGCACAACCATTAGACAAGCACTGTGCAACCAGTTACTTTCAGAACAAGAGACACGC
CCAAAATAGACGCGGAGAGGTCAATATTCACCTTCAAAGACAACTAAAGTCCAAAGGTTCTGTTATACATATCATTTGAACCCAGCATGTGAAAGTTGTT
AGCTTCAGTTGGATATAACATCCTCGACATGTCCGATATGGGAACATTATTCCCCTGTCTCAAATCACTCCAGCCATCCCAGTGACCATTTGCAAGCTGT
GAGTTTCTAGGTTGTTGGAGTGACATCTGTGCATAAGGGGATAGAGAACCATGGTTCTGTGGCAGAAGTCGGGATGCCAGATAATTATCATTCTGAATAG
GGTTGAATGCATCTCGAACATGGTCAGTATATCTGAGGTTTTGATGAGAGGGCATGCTCTGCTGCATAAGTAGTTGAAGTCTTGGATCATTATTTGATGT
CTGCAATTGTGCTGGAAAAGGAG
page-top