Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10422  (registered. 2007)
Contig Information
Length 772 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 1
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_024458 [Oryza sativa (japonica cultivar-group)]
Score 662
Evalue 1.59193e-67
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10422
ACAGGAAACAAAAAGCAATTTGTATAGAGAGGTATAGAAGACGAGAGGAGGATCACAAAAGGGTGATCTCAGAGATTGATGATAATATAGAGGAAGAGTG
TGGCATATGTATGGAAATAAACAACAAAGTTGTCCTTCCAACTTGTAGCCATGCTATGTGCATTAAATGCTACCGTGACTGGAGATCAAGATCCCAGTCC
TGTCCATTCTGCCGCGACAGTCTCAAGAGGGTCAACTCTGCCGACCTCTGGATATACACAGATAACAGAGACATAGTCGACATGGCGACAGTCAGAAGAG
AGAACCTGAGGCGTCTCTTCATGTACATAGATAAGTTGCCCACGGTGATCCCCGAATCTGTTTTCGAGGTATACGATTCCCACGTAAAGTGACCCTGTGC
TTGGCTCGGCGTCGCCCCAATTGTTCATCAGTTGGGTACTGCTAGTGCTGTAGACATTACCAATTGTTTGTCAGTGGGGTGCTGCTAGTGCTGTAGACAT
TGCCGGTTGTTCATCAGTGGGGTGCTGCTAGTGCTGTAGACATTTCTGGAGCCCCGGGCGCCGGCTGCCGCGAGCTTATGAACGCTCCGAGCAGCTCGCC
GGGGAGGCTCTGTATGTATGTGAGGTACTCCTATATATGTAAATTATTGTCGGTTGTATCCACACGGCCTGTGTGATGATGTGTTAGGAGTCTGACGCCT
TGGGCATGTAAGTAATGGATCATTTTTTTTGCGGGCATGTAAGTAATGAATCATTGACTCTTAAAAAAAAAA
page-top