Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10360  (registered. 2007)
Contig Information
Length 691 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_OKCS Seed DPA5 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20582 [Oryza sativa Indica Group] >gi|125594843|gb|EAZ34902.1| hypothetical protein OsJ_018385 [Oryza sativa (japonica cultivar-group)]
Score 83
Evalue 1.78428
Total Hit Count 2
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10360
GGAAATCATCGACAAGTCAGTGATCGAAGAAGAGCTGTTGTCAGTGAAAGATAAAATCAGGGCCCCACTCGTCCAGTCCAGACTCCACGCCGACACCGAT
GAAGACGAAGTGGACGAATGGCCTGACGATGACTCAACCGAGGAGCCCGAGGCGGTAGCGGCAGCAAGCAACAGGGCTTCGCTGGGGCGGGAGGAGGACG
TGTCGTTCAGCGACCTGGAAGACGACGACGACGACGACGGCGGCAATAAAGGGTCGGGCAAGTAGCTAAGATAATTTCTAGGTCCGGTCCCGGCACAATC
ATCCGAGCCTCCATTGGAGCAGTCCCACAAGCACACGCTCGCTGGCTTCACTCAAGGGACTACAGAAGGCAGCGGTGGATGATTACGCGGTCATTATTAG
TCTCCCTCTTGAGAGGCGATGATGATGGATCGTGGAAGCTGGCTGGCTAGCTGGGCCTCCCTCGACTGGCCTGAATTAGAAGAGAAGCACAAAACCAATA
ATGATGGCAAGCAAGTACGTACATCTGTATCGTTTGGCCTGTTTCTGTACATAGAGCCCCCTGGTGCGGGGCTGCATCCTGTATGAACCAACCTGGCAAC
GTACCACTCTGGCCGTCCATCTGTGTGGGCATAATGGTGCAGGTGCGCGCACTCAATAAATCGCTCGATTAGCTGAAAAAGAAAAAAAAAA
page-top