Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10269  (registered. 2007)
Contig Information
Length 686 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_24976 [Oryza sativa Indica Group] >gi|125599188|gb|EAZ38764.1| hypothetical protein OsJ_022247 [Oryza sativa (japonica cultivar-group)]
Score 505
Evalue 2.037e-49
Total Hit Count 22
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10269
GGACCTGATAGCTTAAATAGCCTTGAGAATGAGGTGGCCATCGAGGAATAATCTGTGCCCAGGAAACTCAGTTAACAACTACTAGTACCACTTTGTAGGT
TCGATAACAAACTGGAGAACATGATCATCATGAGTTACGTGATTCTTTTCTCACATGCTCTATACTTCAGAAAAACTGAACTGAGGCCTTGAGCCTGGTT
CACAGCTTTGGATCATGGCCTCCTGGAGCTCAGTAGTTTGGCTTCATGTTGCCGTCGGATGATCAAAGACTGCTGGTAAAGGTTCAGGTCAAGTCCATCA
ACATTCCTGCCCACACGTGCTTGTAGAATCGCATCGTTGTTTGGCTGGATCAGGAGTTCACCGATGAACTGGAACGTGGAATTACTGCAGAAACTAATGT
CTCTCAGGTTTTGAGTATCAATCTTCAGTCTAGCACTGCCATCTTGAATGACAGCAACTGCAGAGTCCACATCATATGACTGAAGGATTCCTGTTACCCG
GATGGATGCCCCTTGCTTGAACATCTCTGAGGAGGGCTCTAGCTCTTGCAAAGTAATAGGCACACCTGGTTTTAGAGTAGAAGATGCCATCTAGCACAGG
GACTGGTTTGCGGTGGTGACCGACGTCGGCGATACGAGGTGATGGTGACTCGCCGTGCTCGACCTCTCTCTCTCTCTCTCTCTCTC
page-top