Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10529  (registered. 2012)
Contig Information
Length 1586 bp
Clones alternative view 83 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_r Root 9
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 5
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_SP 4
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655435|emb|CAJ01702.1|| putative AdoMet synthase 1 [Hordeum vulgare subsp. vulgare]
Score 761
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10529
TTTTTTTTTTAAAAACCTTGAACAGTAGATAAAGTACAGTACTGCTTAGAAGAATGACAATTTGGGAACAATAGGGCAATAGAATTACACATGGGTCTTT
AGACTCTGAAAGAAAGAGCATTATGAGGGGAACTACACAACATGGCTCTTTAGACTCTGGAAGAAAGAGCATTATGAGGGGAAACTACACAAAACAGAGT
ATGAAAAGTGAAAGTGACGGAGTGACAGAGCAAATTGCACATCACTCAGCAGTTTCAGCACACTCAAAAAGAAAAGGAAAAATATATGAAATGATACACC
AGTAAGAAAACTTAGCACTGATCACTAGACGGCACGACCAGTGTAGCACGTCGCGGTGATGTCGAATGCTTCTTCTTACTTCCCAGGAGCAAAAGGATCC
CGCCTTTGTCGAACTTGATAGGCAGCAGACCAAGAATAACCCCAATGTGATTTCTTGTTCTTAGGCAGATGCCTTGTCGAACTTGAGGGGCTTCACCACC
TCCCAGGTGAAGTCGGCATCATCGCGGCCAAAGTGACCATAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGTCCAGGTTGATGCTGATCA
TCCCAGGCCTGAAGTCAAAGTTCTCCTTCACGAGCTTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGACGAACACAGACAGGGGCTC
AGGCACCCCAATGGCGTATGAGATCTGCACAATGCAGCGGCGTGCGAGACCACTGGCGATGATGCTCTTGGCAGCCTGCCTGGCAATGTAGGCACCACTG
CGGTCGACCTTGGTCGGGTCCTTGCCAGAGAAGGCGCCGCCGCCGTGGGCTCCCCAGCCACCGTAGGTGTCGATGATGATCTTGCGGCCGGTGAGACCGG
CATCACCGTGAGGTCCGCCGATGACGAAGCGGCCAGACGGGTTCAGGTGGAAGATGGTGTTCTCATCGAGGTACTTCCCAGGAATCACTGGCTTGATGAC
GTGCTCCTTGAGGTCTGCGGCAATCTCGTCGTTGGTGACGGTCTCGTCATGCTGTGTGGAGATGAGGACGGTGTGCACACGAACAGGCACCATGGCACCA
CCCTCGTTTAGGTACTCAATGGTGACCTGGGTCTTTCCGTCAGGCCTGAGCCAGGCGCAGGTGCCATTCTTGCGGACCTCGGTAAGGCGAGCTCCAAGCT
TGGTGGCGAGCATGTGGGTGAGGGGCATCAGCTCAGGAGTCTCATCGGTGGCGTAGCCGAACATGATGCCCTGGTCACCGGCACCGATCTCTTCAGGGCG
CTTGGTGAAGTGTCCGTGAACACCCTGGGCAATGTCAGGGGATTGCTGCTCGATGTTGACGAGCACCTTGCAATGGTCGGCATCAAGACCGACGTCGTCA
GAGATGAAGCCGATATTGCGGCAGGTGTCGCGCACGATCTTCTCGTAGTCGACGGTGGCCTTGGTGGTGATCTCGCCAAAGACCATGACCATGTTGGTCT
TGGTGCAGGTCTCGCAGGCAACCTTGCTGTCGGGATCCTGGGCCAAGCAGGCGTCCAAGACGGCGTCGGAGACCTGGTCGCACAGC
page-top