Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig10014  (registered. 2007)
Contig Information
Length 752 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27490 [Oryza sativa Indica Group]
Score 514
Evalue 2.19768e-50
Total Hit Count 138
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig10014
TCCCTCCATAAATCCCCTCGCCTCGCTTCCCAAATCCCCTCTCGCCTCCGGCCTCACCTCCGCCGCAGCGGCGGCAGAAGATCGGCTCTTCCTCCATCCG
GTGCCGTTCCAGCTTTTCCTGCGCATCTTTTGGAGCAAAGTTCGCGCCGGAAAGCCTTTTTCTCGCTGGAGGAAAAGGTCGCGGGTTCAATCACAGGTGG
AAAGCTCGTCGCTTTTGCTCCCCTGTCCGTCTTCTTTGGCGGGGGCTTTGGGGAAAGAGGAGGAGAGATCGCTCGCTGCTGGCCTGGGCCGCAAAAGTGA
CGGAAAGCTCATTCAGAAGACCTTGGCTGCTAGGAGATCGGTGAAGTTCTGGTTGTCATTGCAGAGTCTCCGGCAGATATGTCTTTCCGCAGCATAGTCC
GGGATGTTAGAGAGAGCTTCGGAAGCTTATCAAGGCGGGGCTTTGACGTGAGGATTTCAGGCCTCCCTGGTCTTTCCGGCCATCATCACCGGGGGAAGTC
TTTCGGGCCACCGGGTGAGCCGCACGGCGGAGCTGTGGTGGCTGATCAGAATGGCTGGGTTGGTCTTCCTCCTGAATTACTTCGTGATGTGATGAAAAGG
CTGGAGGAAGGCGAGAGCACTTGGCCCTCGCGCAAAGATGTCGTCGCTTGTGCGGCGGTCTGCAGCGCGTGGAGAGAGATCTGTAAAGATATANTTCANA
GCCCGGAGTTCTGTGGGAAACTCACTTTTCCGGTGTCNCTTAAACANCCAGG
page-top