Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9969  (registered. 2007)
Contig Information
Length 1171 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ribosomal protein S18 [Triticum aestivum]
Score 710
Evalue 8.6169e-73
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9969
CAACTCTCAGAGTTCACAAGGAATTCAAGATACAATATATTAAAGGTTCCAGAACCAAAACATTATCTAGGGCAAAACATCATCCAAGGTAATCGTCTAA
ACAAGAACACTCCTTAAGATTGTGGAAATGGACCAACACAGTAGTAGCAAAGCTATGCGGGATCTTTGTGAAGCAGCTTATCGCTTCTTGGAGACACCAA
CAGTCTTTCCTCTCCTGCCGGTAGTCTTTGTGTGCTGACCACGGACACGCACGCCCCAGTAGTGACGAAGACCACGATGGTTCCTGATCTTCTTGAGCCT
CTCAAGGTCATCCCTGAGCTTCATGTCCACGGCGTTGGAGACGACCTGGGAGAACCTGCCGTCCTTATAATCCTTCTTCCTGTTGAGGAACCAGTCCGGC
ACCTTGAACTGGCGCGGGTTGTGCACCACCGCCATCAGGCGGTCCATCTCCTCCGCGGAAAGCTCTCCAGCCCTCTTGTTCATGTCGATGTCGGCCTTCT
TGCAGACGATGTTGGAGAAGCGGCGGCCCACACCCTTGATGGAGGTCAGCGCGAACATGATCTTCTGCTTACCGTCGACGTTGGTGTTGAGCACACGAAG
GATGTGCTGGAACTCCTCACCCGCGATCAGCGACATGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTC
CAATTACCAGACACTAATGCGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGT
GGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCCCTATCCTACCATCGAAAGTTGATAG
GGCAGAAATTTGAATGATGCGTCGCCGGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCGGATCAGCGAGCAGAGCCCGCGTCAGCCTTTT
ATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCACGTATTAGCTCTAGAATTACTACGGTTATCCGAGTAGCACGTACCATCAAACAAACTA
TAACTGATTTAATGAGCCATTCGCAGTTTCACAGTTCAAATTGGTTCATACTTGCACATGCATGGCTTAAT
page-top