Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10510  (registered. 2012)
Contig Information
Length 758 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XA Root 1
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig10510
TTTTTTTTTTGAAAAAACAACAGGAATATGGGCATAGCCTCTTGCATTCAATAAAGTTTTTTTTTTTGGAAAAAACAACAAAATATGCATAAGCAATTCA
AAACAACACCTCATAACCAAGGCAGTGAAGCTGGGTTATGCTGTTTTATAAACTAAACATGATTTAACATGAGCATAGCCTCTTGCATTCAATGAAGTTA
TAACAACTTGGTTTATTGGAGGTGTCAAGCATACATCAGCCAAGGCTTATCACTTGGAAAGTAAAAATATGACAAAGCAACTAGTTGAAACCATTGGCGA
AAAGACAATCATGATTCACTCTCTTTTGCTTGAGCAATTAGGTCTGCTTGCATCTTCTTTATCTCCATCTCCCTTTCCATCCTTTCTTGCTTCTCGTCCT
GGTGGAGGGCGATCCAGACGTGGACCTTGTCCATGGACTCCCAGAAGAGGAACGCGCCGAAGGTCATCCCGAAGAAGGTCGCCACCCGCACCATCTTCTC
CCTCTCCGATCTCTGGCTCCGGCGGATTTGGTGGATTTGGCGACGGCTGCGCGTGCCGTGACCAGCAATGGCCTTGGAGACATGCCTCAGAGGCTGGGCC
CTGCACGCGCCCCAGGCTGGCATCAGGGAACGGCTTAGCAGTGGCAGCTACGCGCCATCCCGGCCAANNACCGCCGCCCCCGCCGTCGTCTCGCCGTCCC
CATACAAGTACGCTCTGGTGGCGGCACGGCGGCCGTCTCGCTTCGTCTGCAAGTGCAA
page-top