Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9938  (registered. 2007)
Contig Information
Length 1036 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0324300 [Oryza sativa (japonica cultivar-group)] >gi|46390502|dbj|BAD15962.1| nuclear protein-like [Oryza sativa Japonica Group] >gi|113536227|dbj|BAF08610.1| Os02g0324300 [Oryza sativa (japonica cultivar-group)] >gi|125539226|gb|EAY85621.1| hypothetical protein OsI_06994 [Oryza sativa Indica Group] >gi|125581886|gb|EAZ22817.1| hypothetical protein OsJ_006300 [Oryza sativa (japonica cultivar-group)]
Score 668
Evalue 5.30451e-68
Total Hit Count 224
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9938
AGTTGGAAATTATTACTCTACCAAGATATGGAGCTTCAGTATGAAATCACCATGTTGCCAGCATGAGATAGTCATACATACGGACCCGAAGAATACTGAG
TATGTTATAATCAGTGGGGCTCAGCGGAAGACTGAAGATTTTGATGTTGAAGATGCAGAGACGCTCCTGCTCCCTGCGGATGAAGAAAGAGACAAGCTTG
CGGATCCCATGTATAAGCTTGAACCACCAGGGAGAGGATATTCGGAAGAAGAAAGAAGAGGAGCCTGTTTTAGTTCGGCTTCAACGCCTCTCTGATAGCC
GTCATTCTGATGATTATTCCCTGAACAGAACCCTCCGCTACCGCCTTAGGGTCATCTAGTGAATTCCTTTGTATAATTTTTCATCAGTAAGTTGTCTAAC
TGTCAGGATTCTTATCCACTTGTTGTCCTATTATTTATGTAGAGCCAAAAGAAGAGAGTTGCTGAAGAGAAGAAATCAGCGAGGAGGATGGGGCTCGGAG
TACGCCTTCTGCCACCCTCCGCAGAGGATGCTGCCGCTGCAGCTCGTGTGAGGTTCGCCTCGAATTTCGAGAAGAACAGGAAGGACAAGAGAGCAGCGAT
CAAGGCCGCCTCCATCTTCCCGGAGCCATCAGGCTCAGCTTCGAAAGACAAGCTAGACCTTGCGCTGAAGAGGCGGAATATAAAAGCTAGTGCAGCGTCG
GCGCTGATGGCGGGCAGGGCAAAGCCGTCGTCGTGGTCGCGGCAGAGCACCGGTTCTGGAAGTGCAAGGACTGCTGTGCCGATATTGGCAAGGCGCAAGT
AGAGCCACACCCCGAGTTGTGCTTGCGCAACCAAGCAAGAATTTTGTGATCTTGTCCGGTCTGTTGCTCAGTACGCCCCATGTATACGTGTATCTTGTGT
AGTACCTTCATTGATCTAGCAGTGTACTGTAACCTTGGTGTTATGTCCTGCTGTCGTGGCTGGGGCTGTGAGCCTGTGACATATCATGAGAAACTGATTT
GCCCTTGTAACTGATGATTCTGGACTAAAAAAAAAA
page-top