Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1050  (registered. 2012)
Contig Information
Length 1459 bp
Clones alternative view 56 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 5
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20530127|dbj|BAB92017.1|| mitochondrial aldehyde dehydrogenase [Secale cereale]
Score 785
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1050
CAACTGATAAAAAAAAACAGATTTACTGCAACCAGAGACTTCTCCAACAAGCGATAATAAACATAATGTTGCTACAACATATATGTCTTGCCGCGGTTGA
CAAAGGAAACCAAATCACATATGATATTTATTAGAGACGGTGGCTGGCTGCCCATGAAGGCAGGGGCTTATTAGTGATCCTCGTTGGTGTCATCATCATC
ATCATCTTCTTCTTCCTCTCCTCATTCAATTATCGCGAGTCTTCACGTTCTCCGGAGTGTCAAGAGGACCATAGTGCGCTATGCTCACAACCACGCGGGG
TTCTTAAGCGCGGTGACGACCGCCTTGACTTGCAGGTAGTTCTTCAGGCTGTCGATGCCCTTCTCCCTACCGATGCCGCTCATCTTGTACCCGCCGAAGG
GGATCGCCGCGTCGAAGATGTCAAAGCAATTCACCCAGACCGTGCCGGCCCTGAGGGCACGCGTCAAGGTGTTGGCCGTGTCCAGGTTGTTGGTGAAAAC
ACCGGCAGCCAATCCGTACTGGCTTGCGTTCGCCCTCTTGATCACCTCGTTGAGGTCATTGAACTTGAAGATTGACTGAACAGGCCCAAATATCTCCTCT
TGGGCAATTTTCATGCCATCCTGCACATCTGAGAAAATTGTTGGCTGGATGTAGTAACCTTTGTCACCCAACTTGTCACCACCCGTCACAAGGGTGGCTC
CACTGTCCACACCCGACTTGATGTAGCGCAAGATCTTCTTGAATTGCTCATCATCAATCTGAGGACCCTGCTCAACACCCTTCCTGAATGGATCACCAAC
TACACGCTTCAAAGCGCGAGCCTTGGACTTCTCAACAAACTCATCATAAACACGCTCATGTACGAACGTGCGAGACCCAGCGCAGCAGCATTGTCCCTGG
TTAAAAAACAGCGCAAAATGCGCAAGCTCAACGGCTTGGTCGATATCTGCATCATCCATGACGATAAAAGGAGACTTGCCTCCTAGCTCCAGTGTCACTG
GCTTAAGATTGCTCCGTGCAGATAACTCAAGAATAACTTTTCCAGTATCGGTTGATCCAGTGAATGCAATCTTGTCAACATCCATGTGGCTAGCAAGAGC
AGCCCCGGCAGTAGGACCGAAACCAGATACGATGTTCAGGACACCTTCGGGTAGTCCAGCCTCATGCAACAGCTTAGAAACATAGAGAGCAGATAGAGGA
GTTTGTTCGGCAGTCTTGAGGACAATAGTGTTTCCACATGCCAAAGCAGGGCCAACTTTCCAGCCATACATCAAAAGTGGGAAGTTCCACGGGATGATCT
GACCCACGACACCAATCGGCTCGTGAAGCACCTGTACATGGTGCGGGCCATCAGCCGGTACGATGAGACCATGGATCTTGTCAGTCCAGCCTGCATAGTA
CCGCATAAGCCGGGCAAGCATCGGCACTTCGATGTGGGCAGCTTGCTCATAGGGCTTCC
page-top