Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9811  (registered. 2007)
Contig Information
Length 770 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26455 [Oryza sativa Indica Group]
Score 865
Evalue 4.59969e-91
Total Hit Count 175
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9811
ATTGTCTCGTCTGCCCCTCCTCCCTCCGTGCTGCCGTCTTTGATTAGGTAGGTGAACTCGGTTATCATGGGCCTCGAGGTAGCAGGTGGCGGGGAAGCCG
CAGTTAAGGGGAAGTTCTGGGGTATAGTTGTCTGTTTTTTCTTGGGAAATGGAAGCCTATTTGCCTGGAACAGTATGCTTACCATCGAGGATTACTATGT
CTCTCTGTTCCCGAATTACCATCCGACAAGAGTTCTTACACTAGTATACCAGCCTTTTGCCTTTGGACTCACCTGCTTCTTTGCATACTATGAAGCAACG
ATGAACACGAGGAAGAGAAATCTAGCTGGTTTTGCACTTTTCTTCCTTAGCTCTTTCGCGTTAATATTGCTGGACGTTGGTACTAAAGGACATGGTGGAA
TTCCAGCATACATTGGTGTATGCATAATCAGTGCCTTTTTTGGGACATCTGATGCTCTTGTTCAAGGTGGCTTGGTTGGCGACCTTTCTTTGATGTGCCC
GGAGTTCATTCAGTCCTTCCTGTCAGGCTTGGCTGCATCAGGAGTTATAACATCAGCTTTGAGACTAATTACAAAGGCAGCTTTCGAGAACTCACAAAAT
GGTCTTCGAAATGGAGCTATGCTATTCTTCTCGGTAACATGCATGTTCGAGCTAGCTTGCCTCCTCCTATATGCATTTGTCTTTCCCAAATTACCCATCG
TGAAGTACTACCGCCAAAAGGCAGCCTCTGAAGGGAGCAAGACTGTTGGCAGCGACCTTGCTGCTGCAGG
page-top