Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig9770  (registered. 2007)
Contig Information
Length 490 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit TaWIN2 [Triticum aestivum]
Score 95
Evalue 0.0290431
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig9770
TGGGACTGGCTAGTTTTTACGTTGGATCGCCAAGCCTATCACAACCCTCCTCCTTTACCCGGGCTTGGGACCGGCTATGCCTAGAAGACATAGGCGGAGT
TGTAGTGTACTAACCAGTAACAAGGAAAAATGTTTACATAGCAGTAGACATTTTTTTAAAATAATGCTCAATAATTTATGTCAGCAGGATGACGCTGGCG
ATGAAATGAGGGATTCAAGCAAGCCTGAGGATGAGCAGTAGTGAAGGGTCCTAGCTACTGCCCTCTTTCTCTCTTAGCCTTCGGGTAGTTATGATGCTTG
TACAAGGACCATTTTCGTGTGTCCTTTGTTGCTGGGTCTTTTACCTACCCTTTCTTTCGTTATATTGTTATACATCGCCGTCCTCGTGCATTATTTTACT
TTACAACTTGAATCCTGCTCGTGTATGCACGGGTTCCTTAAGATTTGAACCAGAGGGTTCAACTCTTGCTTCCTATAATCAAAAAAAAAA
page-top