Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10465  (registered. 2012)
Contig Information
Length 1138 bp
Clones alternative view 72 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 10
WH_XB Root 14
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2492487|sp|Q43470.1|1433B_HORVU|1433B_HORVU RecName: Full=14-3-3-like protein B; Short=14-3-3B
Score 511
Evalue 8.00E-143
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10465
TTTTTTTTTTAGAGCAGCAGAAAAATTTTAAAACCACCAAAGTAACACAAAGGTTCAACAAGAGGCAATAACCAGTGCAGCCCGATAATCAGGCTGTCGA
GCAAGCAAGGCAGCTACAAGCTTCCCTATCACAACACAAATTGGAGCCTCCAATTACCAGCAACCACGATGACATTACAATCTACACTGAACAAGCGAGA
AAGACAAGTTTCTGAACACATAGACAGTGTTTACTGTCCATCTCCAGATTCACCCTTGGGAGCATCCTTCATTTCTTCAGCGGCGTCCTCCGAGATGTCA
GAAGTCCACAGCGTCAGGTTATCACGCAGAAGCTGCATGATCAAAGTGCTGTCCTTGTACGACTCCTCGCTCAGAGAGTCCAGTTCCGAGATGGCCTCAT
CAAAAGCCTGCTTGGCAAGGTCGCAAGCACGGTCAGGCGAGTTGAGGATCTCATAATAGAACACTGAGAAGTTGAGTGCCAGCCCAAGCCTAATAGGATG
AGTCGGGGGCAGCTCTGCAAGTGCAATCTCCTGAGCAGCTTTGTATGCGACCATGGTGTTCTCAGCAGCATCCTTCCTCTCAGTTCCACTCTTGAACTCC
GCAAGGTACCTGTAGTAATCACCCTTCATCTTCAGGTAGAAGACCTTGGACTCTGGAGCAGTAGATGAGGGGACAAGGTGGGAATCAAGAAGCTTGAGGA
TACCATCACAGATCTTGGTGAGCTCAACCTCAATCTTTCCACGGTAGTCCTTGATGAGTGTGACACGGTCCTCATTGCCACGGCTCTCTTCCTTCTGCTC
AATGGAGGAAATGATGCGCCACGAGGCACGGCGGGCACCAATAACATTCTTGTAAGCAACTGATAGAAGGTTGCGCTCCTCGACTGTGAGCTCCTCGGAG
TCAACTGTCTTGGCCACCTTCTCCATGAACTCAACCATCTCCTCGTACCTCTCAGCCTGCTCTGCAAGCTTGGCCATGTACACATTCTCCTCGCGGGAAA
GCTCAGCAGGCTGCGCCATCTTCAGTGTCTGTGGCTTCTAACAGTCACCAAAGATCAATCTCGAGACGAACGGCTGCCGGAGCTGCGGCGTCGGCGGTGG
CGCGGCTGGGGAGGGGAGATCGGCCGCCTTGGTGGCTG
page-top