Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10462  (registered. 2012)
Contig Information
Length 1020 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115451943|ref|NP_001049572.1|| Os03g0251500 [Oryza sativa (japonica cultivar-group)]
Score 395
Evalue 4.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig10462
TTTTTTTTTTGAGCCCGAGAATATAACCACAATGGAAATAACCTTTTATTACATGCTTATTTATGTCCAGACTGCACATCACCCAAAGGCAACCACGAGT
GCACAACTCGTTATTAGCATTACACCAAAATAAGGGTGATGCCACTAGAGTTTTGTTGCCAAACCTCCACAAAAAAATTCCTACCCTTCGTGTAATCCAC
ATCTAAAGAAAAATGATGTTGCACCTCCCTTGCTCGAACAAGGGGCTGGAGTTTTATGATTGATCCGTGACAAACAATGATTGTTCTGGCAACAAGGCCA
CCCACAAGATATTACAGAGACTACAATAGATACAAGAATTTGGACGAGCTCACTCTTCATCCTCACTGATTAGAGCAAACGAGAATGGTGCGAACTTGTA
ACCATCACCCTCATAGAACTTGTTCTGGAACTCCACCCAATGGAGCCTCAAGGCGTGAAGGAACGCGCTTAGGGTCTCCATAACAAGCAACACACCGACA
GTGGCGCAGATGAAGACAACGACACCGATAGCAAGGATAAAAATATTGTTGTACCCCAACGTCAGAAGGAGAACTTTATCATAGAACACAGTGGACAACT
CCGAGTGTGCAAGACTGAGAGCCCAGAGACGAAGATATGAAGCAGTATTTGAGACTGCACCAAGAACAAACTCAATTGTATGGATCAGCTGGTGAACAAA
TATTTCACTGAACTCAAACTCCTCATGGTGGTTCGATTCTTCATTATGCTCCCCTAACTCTGCTACAACTGATTCATCTGCACCCTCAAGCATGGCGTAC
TGATGTCCTTGATGCCTTCGCTCATGTTCCCATTTCAAGAAAAATGGCTTCGGAATCAGCATCCAGGGAACAGATACCAGAGCAAGTAGAAGCAAAACTT
GCTGTAAAGTTTTCTGGCCAGGAAATAACTGGTTCTCTCCCATGTCATCTGTGGGGCTAAGGAACATATATATCATAACATGGTACAGATCTGCTTTTGA
CCCTGTGCACCACTTAATGA
page-top